Diplolepis fructuum

(Rubsaamen, 1896) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cynipidae/Diplolepis

At a glance

Occurrence records215

Data sources6

Biological traits0

DNA specimens22

eDNA detections22

Sources6 archives

Databases and archives Diplolepis fructuum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility215 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF215 records

Environmental DNA1 datasets · 1 countries22 detections

DNA & barcodingBOLD22 specimens

01Narrative

Diplolepis fructuum is een vliesvleugelig insect uit de familie van de echte galwespen (Cynipidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1896 door Rübsaamen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplolepis fructuum has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes2

eDNA detections22

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P376 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.18%

Haplotypes2

BIN1

Most divergent pair1.9%

TAAATAATATAAGATTTTGGTTAATAGTTCCTTCTTTTATTTTATTAATTATAAGTATATTTATTGATCAAGGGGCAGGTACAGGATGAA …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type215 records

Wild obs. + sensor195

Museum / vouchered20

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 80≤1 km 23≤10 km 9>10 km 6

118 georeferenced · 77 without coordinates

Open the mapobservation + sensor195

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 20 records without

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA22 detections

Where the DNA of Diplolepis fructuum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-7.20 °C -7.30–-7.10

Seasonal swing summer↔winter25.3 °C

Max temp (day)-2.50 °C -2.80–-2.10

Min temp (night)-13.5 °C -13.8–-13.2

Precipitation27.6 mm/mo 27.0–28.1

Air humidity63.5 % 63.0–64.0

Moisture balance4.10 mm/mo 3.90–4.30

Vapour deficit132 Pa 129–135

Wind speed2.70 m/s 2.50–2.90

Cloud cover58.7 % 57.8–59.5

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)