Diplogrammus infulatus

Smith, 1963 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Callionymidae/Diplogrammus

At a glance

Occurrence records121

Data sources7

Biological traits7

DNA specimens9

eDNA detections7

Sources7 archives

Databases and archives Diplogrammus infulatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility58 records↗

OBISOcean Biodiversity Information System63 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS121 records

Environmental DNA1 datasets · 3 countries7 detections

DNA & barcodingBOLD9 specimens

01Narrative

Diplogrammus infulatus is een straalvinnige vissensoort uit de familie van pitvissen (Callionymidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1963 door Smith.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length12 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max20 m

Depth min1 m

Vulnerability10

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplogrammus infulatus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes2

eDNA detections7

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

118Cmostly conserved

157Gmostly conserved

169Tvariable

202Cmostly conserved

208Amostly conserved

271Cmostly conserved

278Tmostly conserved

394Cvariable

439Tmostly conserved

454Cvariable

466Gvariable

535Tmostly conserved

544Gmostly conserved

580Tmostly conserved

643Cvariable

CCTTTACCTAGTATTTGGTGCGTGGGCAGGCATGGTTGGCACCGCACTGAGCCTTCTTATTCGAGCAGAGCTAAGCCAGCCGGGCTCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.86%

Haplotypes4

BIN1

Most divergent pair1.7%

AfricaAsia

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

08Occurrence & distribution

Record type121 records

Wild obs. + sensor12

Museum / vouchered108

Other1

Range

Area of Occupancy AOO204 km²

Depth

0–200 m sunlit10

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 17 m · max 275 m · 11 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 1≤10 km 1>10 km 5

7 georeferenced · 5 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 2≤1 km 6≤10 km 10>10 km 2

20 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence108

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	32
Washington, US	5
	5
Toronto, CA	2
CASlocation not on record	1
SNSB-Zoologische Staatssammlung Münchenlocation not on record	1
Frankfurt am Main	1

7 institutions · 47 of 108 vouchered records shown · 3 without an institution code

09Environmental DNA7 detections

Where the DNA of Diplogrammus infulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 22.8–26.7

Seasonal swing summer↔winter6.60 °C

Max temp (day)29.2 °C 25.9–30.4

Min temp (night)22.1 °C 19.8–23.7

Precipitation26.1 mm/mo 7.40–85.5

Air humidity58.4 % 56.9–61.1

Vapour deficit1,312 Pa 1,185–1,404

Cloud cover19.7 % 8.00–35.5

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)