Diplodus puntazzo

(Walbaum, 1792) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Sparidae/Diplodus

At a glance

Occurrence records5 743

Data sources11

Biological traits0

DNA specimens34

eDNA detections42

Sources11 archives

Databases and archives Diplodus puntazzo's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 292 records↗

OBISOcean Biodiversity Information System451 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS5 743 records

Environmental DNA2 datasets · 2 countries42 detections

DNA & barcodingBOLD34 specimens

Genome at a glanceGoaT · NCBI≈788 Mbp

01Narrative

Diplodus puntazzo, also known by its common name sheephead bream, is a species from the genus Diplodus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplodus puntazzo has left across the world's sequence archives.

At a glance

DNA specimens34

BINs2

Marker genes2

eDNA detections42

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

7Avariable

8Tmostly conserved

9Tvariable

26Gvariable

29Gmostly conserved

68Cvariable

93Tvariable

94Cvariable

97Cvariable

136Cvariable

174Tmostly conserved

198Tvariable

249Gmostly conserved

264Cvariable

270Avariable

285Gvariable

287Tmostly conserved

288Avariable

303Tvariable

312Gvariable

399Cmostly conserved

402Cvariable

405Gvariable

468Cvariable

477Cvariable

489Gvariable

510Tvariable

529Cvariable

534Tvariable

537Tvariable

543Tvariable

585Tvariable

600Cmostly conserved

615Tvariable

648Tvariable

CTTTATATTGTATTTGGTGCTTGGGGCGGAATAGTAGGAACTGCCTTAAGCCTGCTCATTCGAGCTGCACTAAGCCAGCCTGGTGCTCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes6

BINs2

Most divergent pair5.0%

AsiaOtherEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Diplodus vulgarissame genus5.2%Diplodus capensissame genus5.2%Diplodus noctsame genus5.2%Diplodus sargussame genus5.2%Diplodus cervinussame genus5.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Diplodus puntazzo carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈788 392 964 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Diplodus puntazzo0.79 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type5 743 records

Wild obs. + sensor4 897

Museum / vouchered272

Other574

Origin

Native6

Range

Area of Occupancy AOO5 108 km²

Depth

0–200 m sunlit241

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10 m · max 100.5 m · 241 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 1 135≤1 km 700≤10 km 108>10 km 70

2 013 georeferenced · 2 884 without coordinates

Open the mapobservation + sensor4 897

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 61≤1 km 1≤10 km 6>10 km 6

74 georeferenced · 198 without coordinates

Open the institutions mapphysical evidence272

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Istituto Superiore per la Protezione e la Ricerca Ambientalelocation not on record	61
Paris, FR	20
Stockholm, SE	6
National Natural History Collectionslocation not on record	5
Cambridge, US	3
Royal Museum for Central Africalocation not on record	2
Barcelona, ES	2
IEO-COMA-CSIClocation not on record	2
FishBaselocation not on record	2
CASlocation not on record	1
SNSB-Zoologische Staatssammlung Münchenlocation not on record	1
MZLUlocation not on record	1
Louisiana State University, Museum of Zoologylocation not on record	1
South African Institute for Aquatic Biodiversitylocation not on record	1

14 institutions · 108 of 272 vouchered records shown · 96 without an institution code

09Environmental DNA42 detections

Where the DNA of Diplodus puntazzo was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys2

Countries2

Verifiable raw sequence linked19

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 10.4–19.1

Seasonal swing summer↔winter24.2 °C

Max temp (day)15.7 °C 15.7–19.7

Min temp (night)3.20 °C 3.20–18.1

Precipitation42.3 mm/mo 7.80–48.7

Air humidity54.3 % 54.3–72.0

Moisture balance-49.4 mm/mo

Vapour deficit708 Pa 605–731

Wind speed2.70 m/s

Cloud cover34.3 % 34.3–38.4

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Diplodus puntazzo

At a glance

Sources11 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 743 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 743 records