Diplodoma laichartingella

(Goeze, 1783) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Psychidae/Diplodoma

At a glance

Occurrence records1 339

Data sources7

Biological traits0

DNA specimens29

eDNA detections113

Sources7 archives

Databases and archives Diplodoma laichartingella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 339 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI113 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 339 records

Environmental DNA3 datasets · 9 countries113 detections

DNA & barcodingBOLD29 specimens

01Narrative

Diplodoma laichartingella is a moth belonging to the genus Diplodoma. The species was first described by Johann August Ephraim Goeze in 1783. It is native to Europe. The wingspan of the moth is 11-13 mm. The head is light yellowish ochreous. Forewings dark fuscous, with some scattered whitish-yellowish dots and strigulae; a subquadrate whitish-yellowish dorsal spot before middle. Hindwings dark grey. Larva dull whitish; head pale brown; plate of 2 darker brown; 3 and 4 laterally brownish-tinged: in a three-sided case, enclosed in an outer shorter case, covered with fragments of refuse, on dead insects, fungus, etc.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplodoma laichartingella has left across the world's sequence archives.

At a glance

DNA specimens29

BINs5

Marker genes2

eDNA detections113

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

4Amostly conserved

49Tmostly conserved

52Amostly conserved

76Amostly conserved

82Tmostly conserved

100Amostly conserved

133Tvariable

136Tmostly conserved

145Cmostly conserved

160Amostly conserved

166Amostly conserved

172Tmostly conserved

181Tvariable

202Amostly conserved

217Amostly conserved

220Tmostly conserved

223Tmostly conserved

229Amostly conserved

232Amostly conserved

262Gvariable

271Tmostly conserved

283Gvariable

322Gvariable

343Amostly conserved

352Tmostly conserved

385Tmostly conserved

397Cvariable

400Cmostly conserved

403Gvariable

407Tvariable

418Tmostly conserved

433Gmostly conserved

445Cmostly conserved

466Amostly conserved

474Cmostly conserved

574Tvariable

589Tmostly conserved

595Tmostly conserved

601Tmostly conserved

616Cmostly conserved

622Tmostly conserved

646Cvariable

AACATTATATTTTATTTTAGGAATTTGAGCAGGAATAATTGGAACATCTTTAAGATTTTTAATTCGAGTAGAATTAGGAATTCCTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes6

BINs5

Most divergent pair5.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Diplodoma adspersellasame genus4.0%Taleporia tubulosasame family9.1%Bankesia desplatsellasame family9.1%Taleporia shosenkyoensissame family9.3%Taleporia politellasame family10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 339 records

Wild obs. + sensor795

Museum / vouchered544

Origin

Native139

Range

Area of Occupancy AOO3 376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 247≤1 km 190≤10 km 318>10 km 2

757 georeferenced · 38 without coordinates

Open the mapobservation + sensor795

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 214≤1 km 59≤10 km 240>10 km 1

514 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence544

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	78
NHMOlocation not on record	71
SLU Artdatabankenlocation not on record	21
Tartu, EE	18
DanishLepidopterologicalSocietylocation not on record	18
Bern, CH	14
Stockholm, SE	6
Provincia di Livornolocation not on record	6
Dhaka, BD	6
Kuopio, FI	4
SFRAlocation not on record	3
Research Collection of Edgardo Bertaccinilocation not on record	2
NMBU:MINAlocation not on record	1
ZSMlocation not on record	1
NTNU-VMlocation not on record	1
Research Collection of Alfred Haslbergerlocation not on record	1
Uniwersytet Łódzkilocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
neflocation not on record	1
MZLUlocation not on record	1

20 institutions · 255 of 544 vouchered records shown · 289 without an institution code

09Environmental DNA113 detections

Where the DNA of Diplodoma laichartingella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found113

Studies independent surveys3

Countries9

Verifiable raw sequence linked84

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 113 detections have coordinates

Open the map9 countries0

1.1. Boreal Forest|1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 13.0–16.4

Seasonal swing summer↔winter19.5 °C

Max temp (day)18.5 °C 16.1–20.2

Min temp (night)10.7 °C 8.80–12.7

Precipitation71.3 mm/mo 54.3–98.7

Air humidity58.8 % 57.0–61.1

Moisture balance-40.6 mm/mo -60.0–-8.70

Vapour deficit685 Pa 578–776

Wind speed2.80 m/s 2.20–4.30

Cloud cover48.4 % 39.2–56.1

CHELSA 1981–2010, ~9 km grid, at location & month of 106 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Diplodoma laichartingella

At a glance

Sources7 archives

At a glance

Record type1 339 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 339 records