Diplocarpon rosae

(Lib.) F.A.Wolf · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Drepanopezizaceae/Diplocarpon

At a glance

Occurrence records2 072

Data sources10

Biological traits0

DNA specimens6

eDNA detections6

Sources10 archives

Databases and archives Diplocarpon rosae's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 070 records↗

OBISOcean Biodiversity Information System2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS2 072 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceGoaT · NCBI68 Mbp

01Narrative

Diplocarpon rosae is a fungus that creates the rose black spot disease.McMaugh, J. What plants pest or disease is that?, New Holland Publishing, Sydney, 2006, , page 231 Because it was observed by people of various countries around the same time (around 1830), the nomenclature for the fungus varied with about 25 different names. The asexual stage is now known to be Marssonina rosae, while the sexual and most common stage is known as Diplocarpon rosae. Diplocarpon rosae grows over seasons as mycelia, ascospores, and conidia in infected leaves and canes. In the spring during moist, humid conditions, ascospores and conidia are wind-borne and rain-splashed to newly emerging leaf tissue.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplocarpon rosae has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes1

GenBank sequences10

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV270026.1 ↗517 bpSouth Korea · 2023

ACGT

GTAGGTGAACCTGCGGAAGGATCATTACCATAGACCCAGCCCGTCGCCGGTCGGCGGCCCGCTGCCTCTATACCCGTGCCTACCGTACCC …

Diplocarpon rosae strain KNUF-24-SC small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Diplocarpon rosae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size67 790 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Diplocarpon rosae0.07 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness95.2% BUSCO

08Occurrence & distribution

Record type2 072 records

Wild obs. + sensor1 509

Museum / vouchered558

Other5

Range

Area of Occupancy AOO5 352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 603≤1 km 87≤10 km 635>10 km 45

1 370 georeferenced · 139 without coordinates

Open the mapobservation + sensor1 509

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 13≤1 km 34≤10 km 291>10 km 62

400 georeferenced · 158 without coordinates

Open the institutions mapphysical evidence558

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ILLSlocation not on record	178
Bernard Price Institute for Palaeontological Researchlocation not on record	65
Catholic University of Pekinglocation not on record	41
Madison, US	38
DPIlocation not on record	37
Pullman, US	20
Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record	18
Auckland, NZ	15
FLASlocation not on record	13
Tartu, EE	8
Hirosaki Universitylocation not on record	8
Helsinki, FI	7
WU-MYClocation not on record	7
Museo Entomologico de Leonlocation not on record	7
St. Paul, US	7
Champaign, US	6
Kensington, AU	5
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	4
TENN-Flocation not on record	4
New Brunswick, US	4
Clemson, US	4
Bronx, US	3
Toronto, CA	3
Uniwersytet Łódzkilocation not on record	3
LDlocation not on record	3
University of Tennessee at Chattanoogalocation not on record	3
Canberra, AU	3
SLU Artdatabankenlocation not on record	2
Karlsruhe, DE	2
Uppsala, SE	2
Kew, GB	2
Leicester, GB	1
McWane Science Centerlocation not on record	1
Mlocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
Lincoln, US	1
Baton Rouge, US	1
Adam Mickiewicz University in Poznańlocation not on record	1
San Sebastián, ES	1
Gijón, ES	1
Chapel Hill, US	1
Odawara, JP	1
MeiseBGlocation not on record	1

43 institutions · 534 of 558 vouchered records shown · 21 without an institution code

09Environmental DNA6 detections

Where the DNA of Diplocarpon rosae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–7.40

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C

Min temp (night)3.00 °C

Precipitation344 mm/mo

Air humidity64.9 %

Moisture balance263 mm/mo

Vapour deficit428 Pa

Wind speed2.90 m/s

Cloud cover44.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Diplocarpon rosae

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 072 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions23 of 43 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 072 records