Diplocarpon mali

Y.Harada & Sawamura · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Drepanopezizaceae/Diplocarpon

At a glance

Occurrence records14

Data sources10

Biological traits0

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Diplocarpon mali's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS44 compounds

Occurrence & distributionGBIF14 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceGoaT · NCBI≈52 Mbp

01Narrative

Diplocarpon mali is a plant pathogen that causes Marssonina blotch on apple.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition44 compounds

Compounds documented for Diplocarpon mali across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Indolizidine alkaloids15

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids6

Aporphine alkaloids $ Isoquinoline alkaloids6

Cadinane sesquiterpenoids3

Isoquinoline alkaloids3

Documented compounds44 total

Tissue Source Quantified only

Compound	Amount	Source
(13bS)-2,12-dimethoxy-5,6,8,9-tetrahydroindolo[7a,1-a]isoquinolin-3-one	present	NPASS
(2R,13bS)-12-hydroxy-2-methoxy-1,2,8,9-tetrahydroindolo[7a,1-a]isoquinolin-6-one	present	NPASS
(2R,13bS)-2,12-dimethoxy-1,2,5,6,8,9-hexahydroindolo[7a,1-a]isoquinolin-3-one	present	NPASS
(2R,13bS)-2,12-dimethoxy-1,2,8,9-tetrahydroindolo[7a,1-a]isoquinolin-6-one	present	NPASS
(2R,13bS)-2,12-dimethoxy-2,6,8,9-tetrahydro-1H-indolo[7a,1-a]isoquinoline	present	NPASS
(2R,3R,13bS)-2,12-dimethoxy-2,3,5,6,8,9-hexahydro-1H-indolo[7a,1-a]isoquinolin-3-ol	present	NPASS
(2R,4aR,13bS)-2-methoxy-2,4a,5,6,8,9-hexahydro-1H-indolo[7a,1-a]isoquinolin-12-ol	present	NPASS
(2R,4aS,13bS)-2,12-dimethoxy-2,4a,5,6,8,9-hexahydro-1H-indolo[7a,1-a]isoquinoline	present	NPASS
(2R,4aS,13bS)-2-methoxy-2,4a,5,6,8,9-hexahydro-1H-indolo[7a,1-a]isoquinolin-12-ol	present	NPASS
(2R,4aS,9S,13bS)-2,9-dimethoxy-2,4a,5,6,8,9-hexahydro-1H-indolo[7a,1-a]isoquinolin-12-ol	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplocarpon mali has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAB609190.1 ↗529 bpJapan · 2007

ACGT

AAGGATCATTACCATACCCGGCCCCCCGCGGGCCGCGTATACCACCCGTGCCTACCCTACCTCTGTTGCTTTGGCGAGGCGTCCCCCCTG …

Diplocarpon mali genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, country: Japan:Iwate, Morioka

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Diplocarpon mali carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈51 728 506 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Diplocarpon mali0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type14 records

Wild obs. + sensor6

Museum / vouchered8

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 5 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
UAclocation not on record	1
WU-MYClocation not on record	1
DPIlocation not on record	1

3 institutions · 3 of 8 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Diplocarpon mali was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–7.40

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C

Min temp (night)3.00 °C

Precipitation344 mm/mo

Air humidity64.9 %

Moisture balance263 mm/mo

Vapour deficit428 Pa

Wind speed2.90 m/s

Cloud cover44.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)