Diplatia tomentosa — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Santalales/Loranthaceae/Diplatia

At a glance

Occurrence records57

Data sources5

Biological traits15

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Diplatia tomentosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility57 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF57 records

DNA & barcodingNCBIsequences

01Narrative

Diplatia tomentosa là một loài thực vật có hoa trong họ Loranthaceae. Loài này được Barlow mô tả khoa học đầu tiên năm 1966.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRY

Size & morphology4

Fruit length7 mm

Leaf length75 mm

Leaf width17.5 mm

Petiole length0.5 cm

Life cycle & reproduction4

Flowering timennnnnnyyyyyy

Life formhemiparasitic epiphyte

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteobligatory

Habitat & environment6

Climatewet tropical

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

Leaf shapenarrowly_ovate oblong

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplatia tomentosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSOM249620.1 ↗5 846 bp

ACGT

TACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTG …

Diplatia tomentosa voucher D. L. Nickrent 4457 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type57 records

Wild obs. + sensor5

Museum / vouchered52

Origin

Native4

Range

Area of Occupancy AOO116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 2 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 15≤1 km 2≤10 km 14

31 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence52

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	20
Smithfield, AU	13
Canberra, AU	7
Mount Annan, AU	4
Honolulu, US	1
Palmerston, AU	1

6 institutions · 46 of 52 vouchered records shown · 6 without an institution code