Diospyros humilis

(R.Br.) F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ebenaceae/Diospyros

At a glance

Occurrence records2 277

Data sources6

Biological traits25

DNA specimens4

eDNA detections3

Sources6 archives

Databases and archives Diospyros humilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 277 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF2 277 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Хурма низкая — растение семейства Эбеновые (Ebenaceae), вид рода Хурма, произрастающий в Австралии. Оно может расти вдоль морских берегов, в лесах и кустарниковых порослях.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology8

Fruit length13 mm

Fruit width10 mm

Leaf length27.5 mm

Leaf width11 mm

Petiole length0.4 cm

Plant height15 m

Seed length7.5 mm

Seed width5 mm

Life cycle & reproduction5

Flowering timennnnnnnnnnyy

Life formshrub or tree

Life spanperennial

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapeelliptical obovate widely_elliptical widely_obovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diospyros humilis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJQ667289.1 ↗530 bpAustralia

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAGGATACTGATATCTTGGCAGCA …

Diospyros humilis voucher JCU_IB07 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa

plant barcode

08Occurrence & distribution

Record type2 277 records

Wild obs. + sensor634

Museum / vouchered1 187

Cultivated / captive3

Other453

Origin

Native57

Range

Area of Occupancy AOO5 332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 219≤1 km 12≤10 km 4>10 km 6

241 georeferenced · 393 without coordinates

Open the mapobservation + sensor634

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 157≤1 km 81≤10 km 475>10 km 104

817 georeferenced · 370 without coordinates

Open the institutions mapphysical evidence1 187

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	317
Palmerston, AU	157
Smithfield, AU	139
Museo Entomologico de Leonlocation not on record	94
Canberra, AU	77
Kensington, AU	45
Mount Annan, AU	37
Adelaide, AU	18
Armidale, AU	14
Saint Louis, US	5
James Cook Townsvillelocation not on record	3
Honolulu, US	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Papua New Guinea Forest Research Institutelocation not on record	1
CSIROlocation not on record	1
Australian Tropical Herbariumlocation not on record	1
BGPAlocation not on record	1

17 institutions · 913 of 1 187 vouchered records shown · 274 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Diospyros humilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 20.9–25.6

Seasonal swing summer↔winter8.90 °C

Max temp (day)28.8 °C 26.2–31.3

Min temp (night)18.2 °C 16.3–20.1

Precipitation71.1 mm/mo 62.3–80.0

Air humidity58.3 % 57.8–58.9

Moisture balance-80.9 mm/mo -114–-47.9

Vapour deficit1,208 Pa 1,063–1,353

Wind speed3.10 m/s 2.80–3.40

Cloud cover31.5 % 27.0–36.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Diospyros humilis

At a glance

Sources6 archives

Size & morphology8

Life cycle & reproduction5

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

At a glance

Record type2 277 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 277 records