Diospyros hebecarpa

A.Cunn. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ebenaceae/Diospyros

At a glance

Occurrence records848

Data sources8

Biological traits25

DNA specimens15

eDNA detections8

Sources8 archives

Databases and archives Diospyros hebecarpa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility848 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF848 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD · NCBI15 specimens

01Narrative

Diospyros hebecarpa là một loài thực vật có hoa trong họ Thị. Loài này được A.Cunn. ex Benth. mô tả khoa học đầu tiên năm 1868.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology7

Fruit length32.5 mm

Fruit width32.5 mm

Leaf length97.5 mm

Leaf width41.5 mm

Plant height15 m

⚠ sources differ — GIFT: 15 m · AusTraits: 20 m

Seed length17 mm

Seed width5.5 mm

Life cycle & reproduction6

Flowering timeyynnnnnnnnnn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Self fertilizationabsent

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Diospyros hebecarpa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Naphthoquinones2

Naphthalenes and derivatives $ Naphthoquinones1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
5-Hydroxy-7-methyl-tetralin-1,4-dione	present	LOTUS
Plumbagin	present	LOTUS
Ramentaceone	present	LOTUS

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diospyros hebecarpa has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes4

GenBank sequences2

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLJF738575.1 ↗525 bpPapua New Guinea · 2008

ACGT

GATTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTT …

Diospyros hebecarpa voucher SB2B0130 ribulose-1,5-bisphophate carboxylase oxygenase (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type848 records

Wild obs. + sensor14

Museum / vouchered664

Other170

Origin

Native10

Range

Area of Occupancy AOO1 448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 7≤1 km 2≤10 km 1

10 georeferenced · 4 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 76≤1 km 57≤10 km 237>10 km 19

389 georeferenced · 275 without coordinates

Open the institutions mapphysical evidence664

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	166
Brisbane, AU	164
Canberra, AU	24
Kew, GB	17
Palmerston, AU	16
Honolulu, US	16
Museo Entomologico de Leonlocation not on record	16
Saint Louis, US	10
Mount Annan, AU	9
Kensington, AU	7
University of Stellenboschlocation not on record	5
James Cook Townsvillelocation not on record	4
Fort Worth, US	4
Australian Tropical Herbariumlocation not on record	3
University of the Sunshine Coastlocation not on record	2
Llocation not on record	1
CSIROlocation not on record	1
CSIRO, Tropical Forest Research Centrelocation not on record	1
Taipei, TW	1
Parkville, AU	1
Monastir, TN	1
Armidale, AU	1
ASUlocation not on record	1
St. Paul, US	1
John T. Waterhouse Herbariumlocation not on record	1

25 institutions · 473 of 664 vouchered records shown · 189 without an institution code

09Environmental DNA8 detections

Where the DNA of Diospyros hebecarpa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 18.5–26.7

Seasonal swing summer↔winter6.30 °C

Max temp (day)26.6 °C 22.1–27.8

Min temp (night)20.2 °C 14.3–25.9

Precipitation194 mm/mo 30.7–346

Air humidity62.9 % 54.5–71.0

Moisture balance83.5 mm/mo

Vapour deficit1,052 Pa 706–1,417

Wind speed3.80 m/s

Cloud cover49.7 % 27.6–56.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)