Diospyros eriantha

Champ. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ebenaceae/Diospyros

At a glance

Occurrence records2 773

Data sources12

Biological traits32

DNA specimens9

eDNA detections6

Sources12 archives

Databases and archives Diospyros eriantha's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 773 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources32 traits

Chemical compositionLOTUS · NPASS211 compounds

Occurrence & distributionGBIF2 773 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 30

01Narrative

Diospyros eriantha is a tree in the family Ebenaceae. It grows up to 7 m tall. The fruits are ellipsoid, black, up to 1 cm long. The specific epithet ' is from the Greek meaning "woolly flowers". D. eriantha is found in and around southern China, Indochina, Sumatra, Java, Borneo, Taiwan and the Philippines. Floral tube is long and large. Stamens and pistils are short. New buds shape. New buds are developing into new branches and leaves. Phyllotaxis. Stem branches early. Branchlets are thin and long. Unidentified object on leaf.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Fruit length15 mm

Fruit length max18 mm

Fruit length min12 mm

Leaf size912 mm²

Plant height10 m

⚠ sources differ — GIFT: 10 m · TRY: 15.5 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max500 m

Elevation mean500 m

Epiphyteterrestrial

Growth formtree

Leaf formlanceolate

Woodinesswoody

Physiology & chemistry9

Leaf C:N ratio22.89 g/g

Leaf c409 mg/g

Leaf dry-matter content (LDMC)453 mg/g

Leaf n18.41 mg/g

Leaf p4.01 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)16.86 mm²/mg

Wood density703 mg/cm³

⚠ sources differ — TRY: 703 mg/cm³ · GIFT: 841 mg/cm³

Other traits4

Leaf marginentire

Leaf spinesno

Leaf thornsno

Plant support typefree-standing

03Chemical composition211 compounds

Compounds documented for Diospyros eriantha across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Chalcones27

Flavonols13

Polyprenylated cyclic polyketides (Hop meroterpenoids)9

Hydrocarbons7

Proanthocyanins7

Documented compounds211 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Isolariciresinol-3alpha-O-beta-D-glucopyranoside	present	NPASS
(+)-Leucocyanidin	present	NPASS
(+)-Syringaresinol	present	LOTUS
(-)-Caryophyllene	present	NPASS
(-)-Pinoresinol	present	NPASS
(1R,3aS,5aR,5bR,7aR,9S,11aR,11bR,13aR,13bS)-9-hydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carbaldehyde	present	LOTUS
(1S,3R,4R,5R)-1,3,4-trihydroxy-5-[3-(4-hydroxy-3-methoxyphenyl)prop-2-enoyloxy]cyclohexane-1-carboxylic acid	present	NPASS
(1S,3R,4R,5R)-3-(3-(3,4-Dihydroxyphenyl)Prop-2-Enoyloxy)-1,4,5-Trihydroxycyclohexane-1-Carboxylic Acid	present	NPASS
(1Z,4E)-germacrene B	present	NPASS
(2R)-1-[2,4-dihydroxy-6-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-2-methylbutan-1-one	present	NPASS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diospyros eriantha has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences7

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR199599.1 ↗446 bpChina

ACGT

ACCATCGAGTCTTTGACGCAGTTGCGCCCGAAGCCTTTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCACGCCGTCGCCCCCCCGCCC …

Diospyros eriantha voucher NG124 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Diospyros eriantha carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 151×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — HSU, C.-c. 1967. Preliminary chromosome studies on the vascular plants of Taiwan (I). Taiwania No. 13: 117-130.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 773 records

Wild obs. + sensor2 265

Museum / vouchered492

Other16

Origin

Native40

Range

Area of Occupancy AOO3 452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 1 047≤1 km 166≤10 km 58>10 km 22

1 293 georeferenced · 972 without coordinates

Open the mapobservation + sensor2 265

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 3≤10 km 6>10 km 2

11 georeferenced · 481 without coordinates

Open the institutions mapphysical evidence492

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	64
Guangzhou, CN	55
Beijing, CN	54
TAIElocation not on record	42
Taipei, TW	41
Taipei, TW	36
Kunming, CN	28
Guilin, CN	25
SCAUlocation not on record	12
Guangzhou, CN	11
Nanyue Arboretumlocation not on record	11
National Museum of Natural Sciencelocation not on record	9
Changsha, CN	9
Xiamen, CN	8
Tsukuba, JP	6
South China Normal Universitylocation not on record	6
Paris, FR	5
Chengdu, CN	5
Nanjing, CN	5
Nishihara, JP	4
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	4
Guiyang, CN	3
Wuhan, CN	3
Saint Louis, US	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Zhejiang Universitylocation not on record	2
Cincinnati, US	2
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	2
Wuhan, CN	2
FJFClocation not on record	2
Yangling, CN	2
Hangzhou, CN	2
Central China Normal Universitylocation not on record	2
Seoul, KR	2
University of Stellenboschlocation not on record	1
Zhuzhou, CN	1
Peking Universitylocation not on record	1
Shanghai, CN	1
Herbarium of South China Botanical Gardenlocation not on record	1
Chengdu, CN	1
Sendai, JP	1
Yunnan Universitylocation not on record	1
Fort Worth, US	1

43 institutions · 477 of 492 vouchered records shown · 15 without an institution code

09Environmental DNA6 detections

Where the DNA of Diospyros eriantha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Diospyros eriantha

At a glance

Sources12 archives

Size & morphology5

Life cycle & reproduction4

Diet & foraging1

Habitat & environment9

Physiology & chemistry9

Other traits4

Compound class profile5 classes

Documented compounds211 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 773 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions28 of 43 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 773 records