Diospyros ebenum

J.Koenig ex Retz. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ebenaceae/Diospyros

At a glance

Occurrence records77

Data sources13

Biological traits20

DNA specimens5

eDNA detections4

Sources13 archives

Databases and archives Diospyros ebenum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility77 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Chemical compositionLOTUS · NPASS257 compounds

Occurrence & distributionGBIF77 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 90

01Narrative

Diospyros ebenum est une espèce de plantes à fleurs de la famille des Ebenaceae. C'est un arbre présent dans le sud de l’Inde, au Sri Lanka et en Indonésie. La variété Diospyros ebenum var. acuminata provient du nord des Célèbes, en Indonésie. Il est connu comme « Kaluwara » par un peuple singhalais en raison du bois dur noir de l’arbre. L’Inde et le Sri Lanka ont des lois interdisant le commerce international du bois.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height20 m

Seed mass174 mg

Seed mass max238 mg

Seed mass min109 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry5

Leaf dry-matter content (LDMC)407 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)7.56 mm²/mg

Wood density611 mg/cm³

03Chemical composition257 compounds

Compounds documented for Diospyros ebenum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavanones37

Quinolizidine alkaloids18

Pterocarpan15

Flavonols11

Isoflavones11

Documented compounds257 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-12alpha-Hydroxysophocarpine	present	NPASS
(+)-Corlumine	present	NPASS
(+)-Lupanine	present	NPASS
(+)-Maackiain	present	NPASS
(+)-Medicarpin	present	NPASS
(+)-Sophoranol	present	NPASS
(+)-Ursolic Acid	present	LOTUS
(-)-13beta-Hydroxystylopine	present	NPASS
(-)-14beta-Hydroxymatrine	present	NPASS
(-)-9alpha-Hydroxysophocarpine	present	NPASS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diospyros ebenum has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences10

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLPQ247057.1 ↗520 bpIndia

ACGT

CCAATTTCGGTTTAATAGTACATCCCAACAGGGGACGACCATACTTGTTCAATTTATCTCTTTCAACTTGGATACCATGAGGTGGTCCTT …

Diospyros ebenum voucher KUAB808 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL6

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Diospyros ebenum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 90 n = 45

Ploidydiploid inferred

Chromosome records30–902n range90median90mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 902×CCDB · book-indian_vol1 · CCDB · book-fedorov

CCDB · book-indian_vol1 — Delay, C. 1947

CCDB · book-fedorov — Delay 1947

2n 301×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type77 records

Wild obs. + sensor65

Museum / vouchered11

Other1

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 16≤1 km 39≤10 km 3

58 georeferenced · 7 without coordinates

Open the mapobservation + sensor65

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 2

3 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Miami, US	3
Tampa, US	2
Lanzhou, CN	1
Santa Barbara, US	1
St. Augustine, TT	1
Istituto Agrario Castelnuovolocation not on record	1

6 institutions · 9 of 11 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Diospyros ebenum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.7–25.7

Seasonal swing summer↔winter3.80 °C

Max temp (day)29.7 °C

Min temp (night)22.1 °C

Precipitation130 mm/mo

Air humidity64.2 %

Moisture balance-47.1 mm/mo

Vapour deficit1,194 Pa

Wind speed5.60 m/s

Cloud cover40.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)