Diospyros dichrophylla

(Gand.) De Winter · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ebenaceae/Diospyros

At a glance

Occurrence records2 336

Data sources10

Biological traits22

DNA specimens6

eDNA detections4

Sources10 archives

Databases and archives Diospyros dichrophylla's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 336 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF2 336 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 30

01Narrative

Diospyros dichrophylla (Gand.) De Winter (known as the "poison star-apple" or "Bostolbos") is a Southern African tree belonging to the ebony family of Ebenaceae and closely related to the Persimmon (Diospyros kaki).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height6 m

Plant height max13 m

Plant height min1 m

Seed mass188 mg

Seed mass max229 mg

Seed mass min141 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation min10 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: tree

Woodinesswoody

Physiology & chemistry3

Leaf c473 mg/g

Leaf n24.67 mg/g

Leaf p1.92 mg/g

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diospyros dichrophylla has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences6

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJX572512.1 ↗552 bpSouth Africa · 2010

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Diospyros dichrophylla voucher Abbott9162 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Diospyros dichrophylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 301×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — White, F. & C. G. Vosa. 1980. The chromosome cytology of African Ebenaceae with special reference to polyploidy. Bol. Soc. Brot., sér. 2 2, 53: 275–297.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 336 records

Wild obs. + sensor2 026

Museum / vouchered309

Cultivated / captive1

Range

Area of Occupancy AOO4 248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 1 550≤1 km 115≤10 km 37>10 km 30

1 732 georeferenced · 294 without coordinates

Open the mapobservation + sensor2 026

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced · 305 without coordinates

Open the institutions mapphysical evidence309

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	185
Cape Town, ZA	85
Durban, ZA	8
Saint Louis, US	7
MSB-3054location not on record	5
MeiseBGlocation not on record	3
South African National Biodiversity Institutelocation not on record	2
Instituto de Investigação Científica Tropicallocation not on record	2
Zürich, CH	1
South African Environmental Observations Networklocation not on record	1
University of Johannesburglocation not on record	1
Uppsala, SE	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1

13 institutions · 302 of 309 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Diospyros dichrophylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 11.9–21.1

Seasonal swing summer↔winter6.50 °C

Max temp (day)21.2 °C 17.9–23.8

Min temp (night)12.2 °C 6.30–18.2

Precipitation34.4 mm/mo 32.0–121

Air humidity54.6 % 52.8–64.5

Moisture balance-33.3 mm/mo -42.3–-0.9

Vapour deficit884 Pa 645–893

Wind speed3.60 m/s 3.40–4.20

Cloud cover7.80 % 7.30–24.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Diospyros dichrophylla

At a glance

Sources10 archives

Size & morphology6

Life cycle & reproduction4

Diet & foraging1

Habitat & environment8

Physiology & chemistry3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 336 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 13 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 336 records