Diospyros crassiflora

Hiern · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ebenaceae/Diospyros

At a glance

Occurrence records258

Data sources11

Biological traits24

DNA specimens8

eDNA detections4

Sources11 archives

Databases and archives Diospyros crassiflora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility258 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Chemical compositionLOTUS · NPASS76 compounds

Occurrence & distributionGBIF258 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Diospyros crassiflora est une espèce de plante à fleurs de la famille des Ebenaceae et du genre Diospyros. C'est un arbre que l'on trouve au Nigeria, Cameroun, Guinée équatoriale, Gabon, République du Congo, République démocratique du Congo et en République centrafricaine. Le bois fourni par cette espèce est de couleur noir homogène ou veiné de gris. Les noms commerciaux utilisés pour son bois font référence à sa provenance : ébène d'Afrique, du Cameroun, du Gabon, du Bénin, d'Old Calabar, de Kribi. Les noms vernaculaires locaux incluent notamment abokpo (Edo) au Nigeria; epindé-pindé (Douala), lembé (Baka), mevini (Ewondo) au Cameroun; evila au Gabon; bingo (Issongo), ngoubou (G’Baya) en République centrafricaine; et Mopini en République du Congo.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height17.5 m

⚠ sources differ — GIFT: 17.5 m · TRY: 14.3 m

Plant height max18.29 m

Life cycle & reproduction7

Deciduousnessevergreen

Flowering endApr

Flowering startMar

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio23.39 g/g

Leaf c467 mg/g

Leaf dry-matter content (LDMC)465 mg/g

Leaf n20.5 mg/g

Leaf p1.7 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density828 mg/cm³

03Chemical composition76 compounds

Compounds documented for Diospyros crassiflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Bisabolane sesquiterpenoids11

Menthane monoterpenoids10

Ursane and Taraxastane triterpenoids5

Simple coumarins4

Eudesmane sesquiterpenoids3

Documented compounds76 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	LOTUS
(1R)-1-hydroxy-1-(2-hydroxy-4-methylphenyl)propan-2-one	present	NPASS
(1R,2R,4aR,5R,8aR)-4a-methyl-8-methylidene-2-propan-2-yl-1,2,3,4,5,6,7,8a-octahydronaphthalene-1,5-diol	present	NPASS
(1S,2R,3R,4R,5S)-2-methyl-5-propan-2-ylcyclohexane-1,2,3,4-tetrol	present	NPASS
(24R)-9,19-cycloart-25-ene-3beta,24-diol	present	NPASS
(2R)-2-(2-hydroxy-4-methylphenyl)propane-1,2-diol	present	NPASS
(2S,7S,11S)-7,11,15-trimethyl-3-methylidenehexadecane-1,2-diol	present	NPASS
(3S,4aS,6aS,6aR,6bR,8aR,12S,12aS,14aR,14bR)-4,4,6a,6b,8a,12,14b-heptamethyl-11-methylidene-1,2,3,4a,5,6,6a,7,8,9,10,12,12a,13,14,14a-hexadecahydropicen-3-ol	present	NPASS
(5S,6S)-5-hydroxy-3-methyl-6-propan-2-ylcyclohex-3-en-1-one	present	NPASS
(E)-2-Isopropyl-5-methylphenyl 2-methylbut-2-enoate	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diospyros crassiflora has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes5

GenBank sequences3

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLMZ274087.1 ↗157 874 bp

ACGT

TAGCTTAATTTCGTTATGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTAATCCACTTGGCTACATCC …

Diospyros crassiflora voucher BR<BEL>:Wursten E5-870 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type258 records

Wild obs. + sensor35

Museum / vouchered223

Range

Area of Occupancy AOO556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 35 records without

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 1≤1 km 1≤10 km 6

8 georeferenced · 215 without coordinates

Open the institutions mapphysical evidence223

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	38
Yaoundé, CM	32
Saint Louis, US	31
BRLUlocation not on record	27
Kew, GB	14
Plocation not on record	10
LBVlocation not on record	10
Brussels, BE	6
Edinburgh, GB	6
WAGlocation not on record	4
Herbier National du Gabonlocation not on record	4
Paris, FR	3
National Botanical Gardens of Belgiumlocation not on record	2
EFGlocation not on record	1
University of Santo Tomas Museumlocation not on record	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Leiden University Medical Centerlocation not on record	1
MAlocation not on record	1
CJBGlocation not on record	1
Universite Libre de Bruxelles, Herbariumlocation not on record	1

20 institutions · 194 of 223 vouchered records shown · 29 without an institution code

09Environmental DNA4 detections

Where the DNA of Diospyros crassiflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 23.6–24.7

Seasonal swing summer↔winter1.00 °C

Max temp (day)29.1 °C 28.3–29.3

Min temp (night)20.8 °C 20.6–21.4

Precipitation153 mm/mo 67.2–190

Air humidity66.5 % 66.4–71.1

Moisture balance34.4 mm/mo -50.6–60.7

Vapour deficit1,009 Pa 844–1,043

Wind speed1.10 m/s 1.10–1.30

Cloud cover52.7 % 52.1–54.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)