Diospyros candolleana — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ebenaceae/Diospyros

At a glance

Occurrence records216

Data sources6

Biological traits10

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Diospyros candolleana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility216 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF216 records

DNA & barcodingNCBIsequences

01Narrative

Diospyros candolleana là một loài thực vật có hoa trong họ Thị. Loài này được Wight mô tả khoa học đầu tiên năm 1848.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Diospyros candolleana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Lupane triterpenoids3

Documented compounds3 total

Compound	Amount	Source
Betulin	present	LOTUS
Betulinic Acid	present	LOTUS
Lupeol	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diospyros candolleana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPP858892.1 ↗562 bpIndia

ACGT

AGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATA …

Diospyros candolleana voucher KUAB806 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1

plant barcode

08Occurrence & distribution

Record type216 records

Wild obs. + sensor183

Museum / vouchered33

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 178>10 km 3

181 georeferenced · 2 without coordinates

Open the mapobservation + sensor183

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 33 records without

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	29
Saint Louis, US	2
Wlocation not on record	1

3 institutions · 32 of 33 vouchered records shown · 1 without an institution code