Diospyros buxifolia

(Blume) Hiern · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ebenaceae/Diospyros

At a glance

Occurrence records318

Data sources9

Biological traits24

DNA specimens10

eDNA detections6

Sources9 archives

Databases and archives Diospyros buxifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility318 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Chemical compositionLOTUS · NPASS37 compounds

Occurrence & distributionGBIF318 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Diospyros buxifolia atau kayu gading gajah adalah pohon dalam keluarga Ebenaceae. Tumbuh hingga 30 meter (100 ft) tinggi. Perbungaan menghasilkan hingga lima bunga. Buahnya berbentuk ellipsoidal, hingga 16 cm (6 in) panjang. Julukan khusus buxifolia</link> berasal dari bahasa Latin, mengacu pada kemiripan daun dengan genus Buxus. Habitatnya adalah hutan dari permukaan laut sampai 1.000 meter (3.300 ft) ketinggian. D. buxifolia ditemukan secara luas dari India hingga Indochina dan di Malesia hingga New Guinea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Leaf length31 mm

Leaf width16 mm

Plant height25 m

Plant height max35 m

Seed length1.8 mm

Seed width max0.7 mm

Life cycle & reproduction5

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)363 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density775 mg/cm³

Other traits3

Leaf thickness0.01 mm

Plant support typefree-standing

Seed height max0.3 mm

03Chemical composition37 compounds

Compounds documented for Diospyros buxifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Lupane triterpenoids7

Cinnamic acids and derivatives $ Phenylethanoids4

Iridoids monoterpenoids4

Dibenzylbutyrolactone lignans3

Flavonols3

Documented compounds37 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	NPASS
(-)-Arctigenin	present	NPASS
(-)-Arctiin	present	NPASS
(1R,3aR,5aR,5bR,7aR,9S,11aR,11bS,13aR,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-ol	present	LOTUS
(1R,3aS,5aR,5bR,7aR,9S,11aR,11bS,13aR,13bR)-3a-(hydroxymethyl)-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-ol	present	LOTUS
(1R,3aS,5aR,5bR,7aR,9S,11aR,11bS,13aR,13bR)-9-hydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	LOTUS
(1R,3aS,5aR,5bR,7aR,9S,11aR,11bS,13aR,13bS)-9-hydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	LOTUS
(1S,4aS,7S,7aS)-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-7-carboxylic acid	present	NPASS
(2E)-8-hydroxy-2-(8-hydroxy-4-methoxy-6-methyl-1-oxonaphthalen-2-ylidene)-4-methoxy-6-methylnaphthalen-1-one	present	LOTUS
(3aR,5aS,5bR,7aR,9S,11aR,11bR,13bS)-9-hydroxy-2,2,5a,5b,8,8,11a-heptamethyl-3,4,5,6,7,7a,9,10,11,11b,12,13b-dodecahydro-1H-cyclopenta[a]chrysene-3a-carboxylic acid	present	NPASS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diospyros buxifolia has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes3

GenBank sequences7

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLKJ594672.1 ↗518 bpSingapore · 2009

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTCAATATGAAACCAAAGATACTGATATCTTGGCAGC …

Diospyros buxifolia voucher BT_0070234205 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★rbcLa

plant barcode

08Occurrence & distribution

Record type318 records

Wild obs. + sensor169

Museum / vouchered149

Range

Area of Occupancy AOO604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 66≤1 km 75≤10 km 9>10 km 4

154 georeferenced · 15 without coordinates

Open the mapobservation + sensor169

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤1 km 8>10 km 3

11 georeferenced · 138 without coordinates

Open the institutions mapphysical evidence149

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	18
Kew, GB	9
Baroda, IN	7
Sri Ramaswamy Memorial Universitylocation not on record	3
Moscow State Universitylocation not on record	3
Saint Louis, US	3
Berlin, DE	1
Davis, US	1
University of Stellenboschlocation not on record	1
Honolulu, US	1
Cibinong Science Center, Herbarium Bogorienselocation not on record	1
ASUlocation not on record	1
Edinburgh, GB	1

13 institutions · 50 of 149 vouchered records shown · 97 without an institution code

09Environmental DNA6 detections

Where the DNA of Diospyros buxifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 24.8–28.1

Seasonal swing summer↔winter10.4 °C

Max temp (day)30.5 °C 29.0–31.9

Min temp (night)20.4 °C 19.3–23.6

Precipitation123 mm/mo 109–151

Air humidity55.9 % 52.0–64.3

Moisture balance-13.3 mm/mo -17.8–-4.10

Vapour deficit1,570 Pa 1,240–1,616

Wind speed1.80 m/s 1.70–2.20

Cloud cover31.9 % 25.2–50.2

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)