Dioscorea transversa

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Dioscoreales/Dioscoreaceae/Dioscorea

At a glance

Occurrence records7 561

Data sources9

Biological traits39

DNA specimens9

eDNA detections3

Sources9 archives

Databases and archives Dioscorea transversa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 561 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources39 traits

Occurrence & distributionGBIF7 561 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Dioscorea transversa, the pencil yam, is a vine of eastern and northern Australia.Kew World Checklist of Selected Plant FamiliesGovaerts, R., Wilkin, P. & Saunders, R.M.K. (2007). World Checklist of Dioscoreales. Yams and their allies: 1-65. The Board of Trustees of the Royal Botanic Gardens, Kew. The leaves are heart-shaped, shiny, with 5-7 prominent veins. The seed pods are rounded, green or pink before drying to a straw brown papery texture. The edible tubers are typically slender and long. There are two forms: an eastern rainforest and wet sclerophyll form which doesn't have bulbils, and a northern form which occurs in open forests and has small bulbils and large inground tubers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology17

Fruit length27.5 mm

Fruit width21.5 mm

Leaf length76 mm

Leaf length max120 mm

Leaf length min50 mm

Leaf mass25 mg

Leaf mass per area21.75 g/m2

Leaf size1 948 mm²

Leaf width39 mm

Leaf width max80 mm

Leaf width min20 mm

Petiole length5 cm

Plant height4 m

⚠ sources differ — GIFT: 4 m · AusTraits: 4 m · TRY: 0.85 m

Plant height max20 m

Plant height min1 m

Seed length5.5 mm

⚠ sources differ — TRY: 5.5 mm · AusTraits: 5 mm

Seed width3 mm

Life cycle & reproduction8

Dehiscencedehiscent

Dispersal typewind

Flowering timeyyyynnnnyyyy

Life formclimbing tuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: climber_herbaceous · TRY: Vines (non-woody climbers)

Leaf compoundnesssimple

Leaf shapeovate

Woodinessnon-woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Specific leaf area (SLA)47.95 mm²/mg

Wood density578 mg/cm³

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dioscorea transversa has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKU564792.1 ↗531 bpAustralia · 2013

ACGT

AAGTGTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGATACGAAACCAAAGATACTGATATCTTAGCGGCAT …

Dioscorea transversa ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL6★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type7 561 records

Wild obs. + sensor5 777

Museum / vouchered796

Cultivated / captive8

Fossil1

Other979

Origin

Native561

Range

Area of Occupancy AOO16 128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 4 618≤1 km 340≤10 km 97>10 km 66

5 121 georeferenced · 656 without coordinates

Open the mapobservation + sensor5 777

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 144≤1 km 89≤10 km 364>10 km 68

665 georeferenced · 131 without coordinates

Open the institutions mapphysical evidence796

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy83% within 1 km

≤100 m 1≤1 km 4>10 km 1

6 georeferenced · 2 without coordinates

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	224
Mount Annan, AU	105
Palmerston, AU	94
Museo Entomologico de Leonlocation not on record	89
Canberra, AU	86
Smithfield, AU	69
Kensington, AU	33
Armidale, AU	21
Adelaide, AU	14
John T. Waterhouse Herbariumlocation not on record	13
NSW Dept of Planning, Industry and Environmentlocation not on record	9
Kew, GB	9
James Cook Townsvillelocation not on record	6
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	4
Wollongong, AU	2
Auckland, NZ	2
Zürich, CH	1
Hobart, AU	1
Uppsala, SE	1
University of the Sunshine Coastlocation not on record	1

20 institutions · 784 of 796 vouchered records shown · 12 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Dioscorea transversa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 19.0–22.2

Seasonal swing summer↔winter10.6 °C

Max temp (day)26.9 °C 23.7–27.3

Min temp (night)17.5 °C 15.0–17.5

Precipitation118 mm/mo 106–129

Air humidity60.1 % 57.8–60.8

Moisture balance-40.4 mm/mo -51.2–2.80

Vapour deficit1,044 Pa 867–1,129

Wind speed2.60 m/s 2.50–3.00

Cloud cover21.1 % 21.1–24.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dioscorea transversa

At a glance

Sources9 archives

Size & morphology17

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

At a glance

Record type7 561 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 561 records