Dioscorea sansibarensis

Pax · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Dioscoreales/Dioscoreaceae/Dioscorea

At a glance

Occurrence records427

Data sources12

Biological traits17

DNA specimens19

eDNA detections10

Sources12 archives

Databases and archives Dioscorea sansibarensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility427 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF427 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD · NCBI19 specimens

Genome at a glanceCCDB · GoaT · NCBI≈270 Mbp

01Narrative

Dioscorea sansibarensis is a species of flowering plant in the yam family known by the common name Zanzibar yam. It is native to Madagascar and to tropical Africa from Tanzania west to Guinea and south to Mozambique,Kew World Checklist of Selected Plant Families and it is known elsewhere as an introduced species (including in southern Florida).Gucker, Corey L. 2009. Dioscorea spp. In: Fire Effects Information System, [Online]. U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory.Biota of North America Program, 2013 county distribution mapUSDA Plants Profile Dioscorea sansibarensis grows from a tuber up to 40 centimeters wide. The vine may exceed 7 meters in lengthDioscorea sansibarensis. Flora of North America. and can be 3 centimeters wide. It twines counterclockwise and can reach and grasp supporting trees before it produces its first leaf. The heart-shaped leaves are up to 46 centimeters long by 58 wide. The tip may taper into a tail-like extension. The bulbils are up to 6 centimeters wide and may be purplish. In parts of Africa this plant is thought to have magical properties. The tubers and bulbils are toxic.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height10.5 m

Plant height max6.1 m

Plant height min4.57 m

Seed mass15.43 mg

Seed mass max15.43 mg

Seed mass min15.43 mg

Life cycle & reproduction3

Life formclimbing tuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Climber

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition1 compounds

Compounds documented for Dioscorea sansibarensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Monomeric stilbenes1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
3,4-Dimethoxy-6-(2-phenylethyl)-1,2-benzenediol		present	LOTUS

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dioscorea sansibarensis has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes7

GenBank sequences10

eDNA detections10

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLKR087056.1 ↗552 bpMozambique · 2010

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTACGAAACCAAAGATACTGATATCTTAGCGGCA …

Dioscorea sansibarensis voucher OM2421 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL7★rbcLa★trnL-FPY-IGSrpL32-trnLtrnH-psbA

plant barcodemarker

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Dioscorea sansibarensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈270 435 472 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dioscorea sansibarensis0.27 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–402n range40median40mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 406×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants · CCDB · Cave1956supp

CCDB · book-fedorov — Smith B. W. 1937

CCDB · book-fedorov — Martin F. w., Ortiz 1963

CCDB · book-fedorov — Miege 1954.

CCDB · book-atlas-flowering-plants — B. Vf. Smith 1937

CCDB · Cave1956supp — Miege 1954

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

07Deep time~34.2 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin34.2 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type427 records

Wild obs. + sensor219

Museum / vouchered179

Other29

Range

Area of Occupancy AOO680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 112≤1 km 33≤10 km 15>10 km 3

163 georeferenced · 56 without coordinates

Open the mapobservation + sensor219

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 179 records without

Open the institutions mapphysical evidence179

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	41
Saint Louis, US	19
Paris, FR	10
Tampa, US	10
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	10
South Kensington, GB	7
Adam Mickiewicz University in Poznańlocation not on record	7
Instituto de Investigação Científica Tropicallocation not on record	4
Plocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
IBANNlocation not on record	4
HNBlocation not on record	4
Yaoundé, CM	4
MeiseBGlocation not on record	4
Université du Lomélocation not on record	3
TAFORI-LSRClocation not on record	2
National Herbarium of São Tomé and Principelocation not on record	2
Valdosta State Universitylocation not on record	2
Coimbra, PT	2
GAlocation not on record	1
CNF-UFHBlocation not on record	1
University of Stellenboschlocation not on record	1
Clocation not on record	1
Herbier National du Gabonlocation not on record	1
LSFlocation not on record	1
University of Johannesburglocation not on record	1
UFMGlocation not on record	1
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	1
BRLUlocation not on record	1
LBVlocation not on record	1
UJlocation not on record	1

31 institutions · 155 of 179 vouchered records shown · 24 without an institution code

09Environmental DNA10 detections

Where the DNA of Dioscorea sansibarensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.5 °C 26.5–26.5

Seasonal swing summer↔winter6.80 °C

Max temp (day)30.8 °C

Min temp (night)22.5 °C

Precipitation144 mm/mo

Air humidity62.0 %

Moisture balance-4.10 mm/mo

Vapour deficit1,317 Pa

Wind speed2.00 m/s

Cloud cover50.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)