Dioscorea bulbifera
speciesAt a glance
Occurrence records10 593
Data sources15
Biological traits50
DNA specimens90
eDNA detections87
Sources15 archives
Databases and archives Dioscorea bulbifera's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility10 593 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI87 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics90 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources50 traits
Chemical compositionLOTUS · NPASS101 compounds
Occurrence & distributionGBIF10 593 records
Environmental DNA1 datasets · 6 countries87 detections
DNA & barcodingBOLD · NCBI90 specimens
Genome at a glanceCCDB · GIFT · GoaT1.2 Gbp
01Narrative
L'hoffe, igname bulbifère, pomme-en-l'air à l'île de La Réunion, masako en Guyane, koko-bourik ou koko-milé en Martinique, "adò" en Guadeloupe, ou encore pomme Edward aux Seychelles, est une espèce de plantes de la famille des Dioscoreaceae. Cette plante grimpante originaire d'Afrique de l'Est et proche de l'igname, donne des tubercules aériens comestibles, d'où son nom vernaculaire. Elle s'est répandue sur toutes les côtes est de l'océan Indien, puis dans les zones tropicales où elle est devenue envahissante.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology21
Fruit length24 mm
⚠ sources differ — AusTraits: 24 mm · GIFT: 22.5 mm
Fruit length max30 mm
Fruit length min15 mm
Fruit width8.5 mm
⚠ sources differ — AusTraits: 8.5 mm · GIFT: 10 mm
Fruit width max15 mm
Fruit width min5 mm
Leaf length175 mm
Leaf length max240 mm
Leaf length min40 mm
Leaf size2 994 mm²
Leaf width175 mm
Leaf width max200 mm
Leaf width min30 mm
Petiole length8.5 cm
Plant height11 m
⚠ sources differ — GIFT: 11 m · AusTraits: 5 m
Plant height max10 m
Plant height min1 m
Seed length4.5 mm
Seed mass5.68 mg
Seed mass max5.68 mg
Seed mass min5.68 mg
Life cycle & reproduction9
Deciduousnessvariable
Dehiscencedehiscent
Dispersal typeself
Flowering timenyyynnnnnnnn
Life formclimbing tuberous geophyte
Life spanperennial
Raunkiær life formcryptophyte
Resprouting capacityresprouts
Sex typedioecious
Diet & foraging1
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climateseasonally dry tropical
Climberobligatory
Elevation max2 300 m
Elevation mean2 000 m
Elevation min20 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: climber_herbaceous · TRY: L
Habitat GIFTÁrea Antrópica, Cerrado (lato sensu)
Leaf compoundnesssimple
Leaf shapeovate
Mycorrhiza typearbuscular
Succulenceno
Woodinessnon-woody
Physiology & chemistry3
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)39.5 mm²/mg
03Chemical composition101 compounds
Compounds documented for Dioscorea bulbifera across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Colensane and Clerodane diterpenoids33
Flavonols13
Spirostane steroids12
Phenanthrenes9
Monomeric stilbenes7
Documented compounds101 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,2S,5R,8S,10S,11R,13R)-8-(furan-3-yl)-10-methyl-7,14-dioxatetracyclo[11.2.1.02,11.05,10]hexadecane-3,6,15-trione | present | LOTUS | |
| (1R,2S,5S,7S,8S,10S,13S)-10-(furan-3-yl)-8-(hydroxymethyl)-4,11,14-trioxapentacyclo[11.2.2.12,5.01,7.08,13]octadecane-3,12,15-trione | present | LOTUS | |
| (1R,4R,5R)-2,4'-dimethylspiro[2-azabicyclo[2.2.2]octane-5,2'-3H-pyran]-6'-one | present | LOTUS | |
| (1R,4S,5R,7S,8S,9S)-5-(furan-3-yl)-7-methoxy-4,10-dimethyl-15-oxatetracyclo[6.5.2.01,9.02,6]pentadeca-2(6),10-diene-3,14-dione | present | LOTUS | |
| (1R,4S,5S,8R,9S,10R,11R)-5-(furan-3-yl)-11-hydroxy-4,10-dimethyl-15-oxatetracyclo[6.5.2.01,9.02,6]pentadec-2(6)-ene-3,14-dione | present | LOTUS | |
| (1R,4S,7S,9R,10S,12S,15S)-7-(furan-3-yl)-4-hydroxy-6,13,17-trioxapentacyclo[7.6.3.112,15.01,10.04,9]nonadecane-5,14,16-trione | present | LOTUS | |
| (1R,4S,7S,9S,10S,12S,15S)-7-(furan-3-yl)-4-hydroxy-6,13,17-trioxapentacyclo[7.6.3.112,15.01,10.04,9]nonadecane-5,14,16-trione | present | LOTUS | |
| (1R,5S,8S,10S,11S,13R)-8-(furan-3-yl)-5-hydroxy-10-methyl-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-7,14-dioxatetracyclo[11.2.1.02,11.05,10]hexadec-2-ene-6,15-dione | present | LOTUS | |
| (1S,2S,5R,10S,11R,13S)-8-(furan-3-yl)-10-methyl-7,14-dioxatetracyclo[11.2.1.02,11.05,10]hexadecane-3,6,15-trione | present | LOTUS | |
| (1S,2S,7R,9R,12S,16S)-4-(furan-3-yl)-14-hydroxy-2-methyl-5,10-dioxatetracyclo[7.6.1.02,7.012,16]hexadecane-6,11-dione | present | LOTUS |
05DNA & barcoding90 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dioscorea bulbifera has left across the world's sequence archives.
At a glance
DNA specimens90
Marker genes7
GenBank sequences10
eDNA detections87
Countries7
The DNA barcodea real sequence read deposited for this species
GGGGAGCAATACCAAACTTCTTGTTCGAACAAGATATTCGATATTGCTCCTTCAACGATTCATATACATTAAGACAAAAGAAAAGTCTTA …
Dioscorea bulbifera chloroplast, complete genome
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL10★rbcLa★trnL-FPY-IGSrpL32-trnLtrnH-psbA
plant barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Dioscorea bulbifera carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 173 600 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Dioscorea bulbifera1.17 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 60 n = 30
Ploidy6× hexaploid · measured
Chromosome records36–982n range60median60mode16records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 404×CCDB · ipcn-api-dl · CCDB · book-indian_vol2 · GIFT · GIFT (floras)
CCDB · ipcn-api-dl — Pal, A. & A. K. Sharma. 1980. Analysis of cytotypes of Dioscorea and scope of increasing the diosgenin content. Cellule 73: 117–134.
CCDB · book-indian_vol2 — Ghosh, I. & Sharma, A.K. 1969
GIFT · GIFT (floras)
2n 604×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn75-78 · CCDB · kew +1
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · book-ipcn75-78 — 70
CCDB · kew — Obidiegwu JE, Rodriguez E, Ene-obong EE, Loureiro J, Muoneke CO, Santos C, Kolesnikova-Allen M, Asiedu R. 2009. Estimation of the nuclear DNA content in some representative of genus Dioscorea. Scientific Research and Essays 4: 448-452.
GIFT · GIFT (floras)
2n 803×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants · GIFT · GIFT (floras)
CCDB · book-fedorov — Smith B. W. 1937
CCDB · book-atlas-flowering-plants — Nakajima 1936"
GIFT · GIFT (floras)
2n 361×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 501×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Smith, B.W. 1937
2n 541×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 701×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 981×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 101×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 18
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
hexaploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type10 593 records
Wild obs. + sensor6 479
Museum / vouchered3 107
Cultivated / captive190
Other817
Origin
Native362
Introduced31
Range
Area of Occupancy AOO20 080 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy91% within 1 km
≤100 m 3 342≤1 km 520≤10 km 195>10 km 205
4 262 georeferenced · 2 217 without coordinates
Open the mapobservation + sensor6 479
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 95≤1 km 150≤10 km 271>10 km 69
585 georeferenced · 2 522 without coordinates
Open the institutions mapphysical evidence3 107
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 31>10 km 25
56 georeferenced · 134 without coordinates
Open the mapnot free-living190
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions116 of 240 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Kunming, CN | 223 |
| South Kensington, GB | 145 |
| Guangzhou, CN | 139 |
| Kew, GB | 121 |
| Saint Louis, US | 99 |
| Palmerston, AU | 96 |
| Brisbane, AU | 93 |
| MeiseBGlocation not on record | 90 |
| Beijing, CN | 90 |
| Canberra, AU | 75 |
| Guilin, CN | 71 |
| Nanjing, CN | 68 |
| Baroda, IN | 58 |
| Tampa, US | 47 |
| Smithfield, AU | 43 |
| Taipei, TW | 42 |
| Bronx, US | 37 |
| Odawara, JP | 36 |
| Yaoundé, CM | 35 |
| Université de Strasbourglocation not on record | 35 |
| HNBlocation not on record | 31 |
| Kensington, AU | 29 |
| Museo Entomologico de Leonlocation not on record | 28 |
| Tsukuba, JP | 28 |
| Nishihara, JP | 25 |
| Kochi, JP | 25 |
| WAGlocation not on record | 23 |
| Miami, US | 23 |
| BISHlocation not on record | 22 |
| Nishihara, JP | 21 |
| Honolulu, US | 20 |
| University of Stellenboschlocation not on record | 17 |
| Sanda, JP | 17 |
| Adam Mickiewicz University in Poznańlocation not on record | 16 |
| Jena Microbial Resource Collectionlocation not on record | 16 |
| LSF/FSA/UAClocation not on record | 16 |
| Xiamen, CN | 16 |
| Changsha, CN | 16 |
| Auckland, NZ | 15 |
| Taipei, TW | 15 |
| Paris, FR | 15 |
| Plocation not on record | 15 |
| 黔东南州民族医药研究所标本室location not on record | 15 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 14 |
| LBVlocation not on record | 14 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 14 |
| Chengdu, CN | 14 |
| Mexico City, MX | 13 |
| Herbier National du Gabonlocation not on record | 13 |
| Chengdu, CN | 13 |
| Frankfurt am Main | 12 |
| Guangzhou, CN | 12 |
| CASlocation not on record | 11 |
| Durango, MX | 11 |
| Moscow State Universitylocation not on record | 11 |
| Yangling, CN | 11 |
| Edinburgh, GB | 11 |
| TAIElocation not on record | 11 |
| Hangzhou, CN | 10 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 10 |
| Christchurch, NZ | 10 |
| CNF-UFHBlocation not on record | 10 |
| National Biodiversity Institute, Costa Ricalocation not on record | 9 |
| Mount Annan, AU | 9 |
| Chiba, JP | 9 |
| Université du Lomélocation not on record | 8 |
| Durban, ZA | 8 |
| US | 8 |
| Tokushima, JP | 8 |
| Taipei, TW | 8 |
| Dresden, DE | 7 |
| Zhejiang Universitylocation not on record | 7 |
| nlocation not on record | 7 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 7 |
| Zürich, CH | 6 |
| Brussels, BE | 6 |
| Zhengzhou, CN | 6 |
| Seoul, KR | 6 |
| Sagamihara, JP | 5 |
| Canadian Department of Agriculturelocation not on record | 5 |
| Kagoshima, JP | 5 |
| Chapingo, MX | 5 |
| Zhuzhou, CN | 5 |
| WNNUlocation not on record | 5 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 5 |
| Kawasaki Shi Tama Ku, JP | 5 |
| San José, CR | 4 |
| MAlocation not on record | 4 |
| Dehra Dun, IN | 4 |
| HUFDlocation not on record | 4 |
| Shanghai, CN | 4 |
| James Cook Townsvillelocation not on record | 4 |
| EFGlocation not on record | 4 |
| Cenargenlocation not on record | 4 |
| Salvador, BR | 4 |
| Loja, EC | 4 |
| Yunnan Universitylocation not on record | 4 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 4 |
| LDlocation not on record | 3 |
| Pretoria, ZA | 3 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 3 |
| Sendai, JP | 3 |
| Chongqing Natural History Museumlocation not on record | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| South China Normal Universitylocation not on record | 3 |
| Ischia Marine Centrelocation not on record | 3 |
| Mérida, MX | 3 |
| Xian, CN | 3 |
| Central China Normal Universitylocation not on record | 3 |
| Bloomington, US | 3 |
| Brasília, BR | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| BRLUlocation not on record | 3 |
| Berlin, DE | 3 |
| Cibinong Science Center, Herbarium Bogorienselocation not on record | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| Zhejiang Museum of Natural Historylocation not on record | 3 |
| Stockholm, SE | 3 |
| Wuhan, CN | 3 |
| HAWlocation not on record | 3 |
| Fort Worth, US | 3 |
| Adelaide, AU | 3 |
| Chengdu, CN | 3 |
| St. Augustine, TT | 2 |
| QCNElocation not on record | 2 |
| Llocation not on record | 2 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 2 |
| UFBAlocation not on record | 2 |
| Uppsala, SE | 2 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 2 |
| IPHAMETRAlocation not on record | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| FUVATESlocation not on record | 2 |
| Tomioka, JP | 2 |
| KURAlocation not on record | 2 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 2 |
| Monastir, TN | 2 |
| Ural Federal University "B. N. Yeltsin"location not on record | 2 |
| UEPAlocation not on record | 2 |
| Universiti Sains Malaysialocation not on record | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Lanzhou, CN | 2 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 2 |
| Burlington, US | 2 |
| Toyama, JP | 2 |
| Tapachula, MX | 2 |
| Philadelphia, US | 2 |
| Coimbra, PT | 2 |
| Peking Universitylocation not on record | 2 |
| Awka, NG | 2 |
| FJIDClocation not on record | 2 |
| Campo Mourão, BR | 2 |
| Montecillo, Texcoco, MX | 2 |
| Central China Agricultural Universitylocation not on record | 2 |
| LSFlocation not on record | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| UFOPlocation not on record | 2 |
| UTFPR-CPlocation not on record | 2 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 2 |
| Glocation not on record | 2 |
| Puerto Ayora, EC | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| University of Zhejianglocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Goucher Collegelocation not on record | 1 |
| Forestry Research Institute of Nigerialocation not on record | 1 |
| Wlocation not on record | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Université National du Béninlocation not on record | 1 |
| EAlocation not on record | 1 |
| León, NI | 1 |
| National Natural History Collectionslocation not on record | 1 |
| Université de Bordeauxlocation not on record | 1 |
| Wilkin, P.location not on record | 1 |
| JBRJlocation not on record | 1 |
| Fukushima Universitylocation not on record | 1 |
| National Herbarium and Plant Laboratories, Nepallocation not on record | 1 |
| University of the Sunshine Coastlocation not on record | 1 |
| Brasília, BR | 1 |
| La Trobe Universitylocation not on record | 1 |
| Fayetteville, US | 1 |
| BGPAlocation not on record | 1 |
| Dekalb, US | 1 |
| Cambridge, US | 1 |
| Gump Stationlocation not on record | 1 |
| Chongqing Museumlocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Clemson, US | 1 |
| Nagano City, JP | 1 |
| Cincinnati, US | 1 |
| Foz do Iguaçu, BR | 1 |
| Alcaldía Municipal de Garzón en Huilalocation not on record | 1 |
| Jackson, US | 1 |
| Lake Charles, US | 1 |
| Gifu prefectural Museumlocation not on record | 1 |
| Calabar, NG | 1 |
| Managua, NI | 1 |
| Elocation not on record | 1 |
| Arusha, TZ | 1 |
| Olocation not on record | 1 |
| LISClocation not on record | 1 |
| Porto Alegre, BR | 1 |
| CJBGlocation not on record | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Vancouver, CA | 1 |
| Austin, US | 1 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 1 |
| Cusco, PE | 1 |
| Armidale, AU | 1 |
| National Herbarium of São Tomé and Principelocation not on record | 1 |
| HUAlocation not on record | 1 |
| Cambridge, US | 1 |
| Ivano-Frankivsk, UA | 1 |
| UFMSlocation not on record | 1 |
| Ilhéus, BR | 1 |
| Provo, US | 1 |
| KIWElocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| SCAUlocation not on record | 1 |
| ex-Centro Nacional de Investigação Cientifica (CNIC)location not on record | 1 |
| 武陵山动植物研究所location not on record | 1 |
| Botanic Gardenlocation not on record | 1 |
| Leiden University Medical Centerlocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Addis Ababa, ET | 1 |
| FJFClocation not on record | 1 |
| Millersville, US | 1 |
| GAlocation not on record | 1 |
| Guangxi Medicinal Botanic Gardenlocation not on record | 1 |
| Xian, CN | 1 |
| Nanjing, CN | 1 |
| University of Johannesburglocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| Masindi, UG | 1 |
| UNESP-FCAlocation not on record | 1 |
| UNEMATlocation not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
240 institutions · 2 768 of 3 107 vouchered records shown · 337 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA87 detections
Where the DNA of Dioscorea bulbifera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found87
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 87 detections have coordinates
Open the map6 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.1 °C 20.1–26.1
Seasonal swing summer↔winter13.4 °C
Max temp (day)30.5 °C 25.0–30.5
Min temp (night)19.3 °C 14.0–22.6
Precipitation109 mm/mo 16.3–269
Air humidity52.0 % 50.4–67.1
Moisture balance-17.8 mm/mo -108–133
Vapour deficit1,616 Pa 952–1,616
Wind speed1.80 m/s 1.20–2.80
Cloud cover25.2 % 25.2–57.6
CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.