Dionaea muscipula

Ellis · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Droseraceae/Dionaea

At a glance

Occurrence records2 166

Data sources14

Biological traits12

DNA specimens5

eDNA detections4

Sources14 archives

Databases and archives Dionaea muscipula's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 166 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS · NPASS32 compounds

Occurrence & distributionGBIF2 166 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT · NCBI2.8 Gbp

01Narrative

La Dionée attrape-mouche est une plante carnivore, sans doute la plus connue et la plus emblématique. C'est une plante vivace herbacée de la famille des Droseraceae. C'est la seule espèce du genre Dionaea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height0.05 m

Seed mass0.351 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Forb

Woodinessnon-woody

03Chemical composition32 compounds

Compounds documented for Dionaea muscipula across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Longipinane sesquiterpenoids8

Flavonols8

Naphthoquinones7

Gallotannins3

Naphthalenes and derivatives2

Documented compounds32 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,4S,5S,6R)-2-(4,8-dihydroxy-3-methylnaphthalen-1-yl)oxy-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(3R)-8-hydroxy-3-(hydroxymethyl)-3-methyl-2H-naphthalene-1,4-dione	present	LOTUS
(3S,4S)-4,8-dihydroxy-3-methyl-tetralin-1-one	present	LOTUS
1,4-Naphthalenedione, 5-hydroxy-3-(hydroxymethyl)-2-methyl-	present	LOTUS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one	present	LOTUS
2-(3,4-Dihydroxyphenyl)-5,7-Dihydroxy-3-((2S,3R,4S,5R,6R)-3,4,5-Trihydroxy-6-(Hydroxymethyl)Oxan-2-yl)Oxy-Chromen-4-one	present	LOTUS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3R,4R,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	LOTUS
3,3'-di-O-Methylellagic acid	present	LOTUS
3,3'-Di-O-Methylellagic Acid 4'-Glucoside	present	LOTUS
3-Chloro-5-hydroxy-2-methylnaphthalene-1,4-dione	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dionaea muscipula has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences10

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH767012.1 ↗349 bpUSA · 2017

ACGT

TGCAGAATCCCGTGAACCATCAAGTCTTTGAACGCAAGTTGCACCCGAGGCCACCTAGGCCAAGGGCACGTCTGCCTGGGCGTCTCATAG …

Dionaea muscipula voucher US:Scheffer13 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK2★rbcL5★ITS3

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Dionaea muscipula carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 846 678 571 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dionaea muscipula2.85 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidy2× diploid · measured

Chromosome records30–322n range32median32mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 323×CCDB · book-ipcn67-71 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-ipcn67-71 — KONDO, K. 1970. Chromosome numbers in Drosera and Dionaea in North Carolina. J. Jap. Bot. 45: 139-144.

CCDB · book-fedorov — Behre 1929

CCDB · book-atlas-flowering-plants — Behre 1929

2n 302×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Smith C. M. 1929

CCDB · book-atlas-flowering-plants — C. M. Smith 1929

2n 331×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hoshi, Y. & K. Kondo. 1998. A chromosome phylogeny of the Droseraceae by using CMA-DAPI fluorescent banding. Cytologia 63: 329–339.

n 161×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — KONDO, K. 1970. Chromosome numbers in Drosera and Dionaea in North Carolina. J. Jap. Bot. 45: 139-144.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type2 166 records

Wild obs. + sensor2 054

Museum / vouchered107

Cultivated / captive5

Origin

Native3

Introduced1

Range

Area of Occupancy AOO3 980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy1% within 1 km

≤100 m 8≤1 km 14≤10 km 7>10 km 2 022

2 051 georeferenced · 3 without coordinates

Open the mapobservation + sensor2 054

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 4≤1 km 11≤10 km 17>10 km 15

47 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence107

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 4 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	20
Jena Microbial Resource Collectionlocation not on record	15
Chicago, US	12
St. Paul, US	5
Auckland, NZ	5
Claremont, US	4
Austin, US	3
Miami, US	3
Philadelphia, US	3
WTUlocation not on record	3
Bangkok, TH	2
Chapel Hill, US	2
Millersville, US	2
Saint Louis, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
LDlocation not on record	2
Riverside, US	1
Oskarshamn, SE	1
Museo Entomologico de Leonlocation not on record	1
Denver, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Long Beach, US	1
Cheney, US	1
Flagstaff, US	1
University of New Hampshirelocation not on record	1
Provincia di Livornolocation not on record	1

27 institutions · 96 of 107 vouchered records shown · 11 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Dionaea muscipula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dionaea muscipula

At a glance

Sources14 archives

Size & morphology2

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Compound class profile5 classes

Documented compounds32 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type2 166 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 27 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 166 records