Dioctria oelandica

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Asilidae/Dioctria

At a glance

Occurrence records4 666

Data sources7

Biological traits2

DNA specimens15

eDNA detections86

Sources7 archives

Databases and archives Dioctria oelandica's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 666 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI86 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 666 records

Environmental DNA3 datasets · 4 countries86 detections

DNA & barcodingBOLD15 specimens

01Narrative

Dioctria oelandica is a Palearctic species of robber fly in the family Asilidae. Verrall, G. H., 1909 Stratiomyidae and succeeding families of the Diptera Brachycera of Great Britain British flies Volume 5 London : Gurney and Jackson, 1909.BHL Full text with illustrations

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dioctria oelandica has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections86

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

85Cmostly conserved

217Amostly conserved

289Cmostly conserved

362Gmostly conserved

490Tmostly conserved

500Tmostly conserved

514Amostly conserved

622Amostly conserved

AACCTTATACTTTATTTTTGGTTCATGAGCAGGAATAGTAGGAACATCAATAAGAATTTTAATCCGAACTGAATTAGGTCATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dioctria flavipennissame genus8.0%Dioctria cothurnatasame genus9.4%Dioctria rufipessame genus9.4%Dioctria linearissame genus9.5%Dioctria henshawisame genus9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 666 records

Wild obs. + sensor4 397

Museum / vouchered269

Range

Area of Occupancy AOO6 872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤100 m 489≤1 km 369≤10 km 2 953>10 km 4

3 815 georeferenced · 582 without coordinates

Open the mapobservation + sensor4 397

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 56≤1 km 65≤10 km 76>10 km 2

199 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence269

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	86
NHMOlocation not on record	33
Tilburg, NL	22
CBDClocation not on record	15
SLU Artdatabankenlocation not on record	14
Helsinki, FI	12
Uniwersytet Łódzkilocation not on record	11
Stockholm, SE	9
University of Tokyo, Department of Zoologylocation not on record	8
NEFlocation not on record	7
BioFokuslocation not on record	7
ZMAAlocation not on record	5
Gothenburg, SE	4
Natural History Museum Rotterdamlocation not on record	3
Tromsø, NO	2
Copenhagen, DK	2
NCMGlocation not on record	2
Chicago, US	1
DFlocation not on record	1
Philadelphia, US	1
NMOKlocation not on record	1
neflocation not on record	1

22 institutions · 247 of 269 vouchered records shown · 22 without an institution code

09Environmental DNA86 detections

Where the DNA of Dioctria oelandica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found86

Studies independent surveys3

Countries4

Verifiable raw sequence linked76

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 86 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.3 °C 11.6–14.6

Seasonal swing summer↔winter17.8 °C

Max temp (day)18.2 °C 16.0–19.2

Min temp (night)10.4 °C 7.10–11.2

Precipitation73.1 mm/mo 57.3–92.1

Air humidity60.0 % 58.0–61.1

Moisture balance-43.6 mm/mo -58.4–-15.0

Vapour deficit656 Pa 570–698

Wind speed3.20 m/s 2.50–4.20

Cloud cover43.4 % 39.8–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 86 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dioctria oelandica

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type4 666 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 666 records