Dinophilus taeniatus

Harmer, 1889 · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Eunicida/Dinophilidae/Dinophilus

At a glance

Occurrence records31

Data sources8

Biological traits0

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Dinophilus taeniatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility20 records↗

OBISOcean Biodiversity Information System11 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS31 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Dinophilus taeniatus is a small annelid worm which lives in tidal pools. It is 1.5 – 2.5 mm long and about 150 µm wide, orange in colour, with two distinct dark pigmented eyes on its prostomium. The anterior part of prostomium has four large and many small bristles and sensory cilia. The trunk consist of 11 rings where the first nine rings are distinctly separate. The ventral trunk is densely covered with cilia. It is widely distributed around the UK coast, from the Irish Sea through to the Barents Sea.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dinophilus taeniatus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs2

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)2.1%

Haplotypes2

BINs2

Most divergent pair2.9%

Where individuals differ — all 20 variable positions, in barcode order

5Cvariable

8Cvariable

62Gvariable

71Avariable

74Cvariable

188Cvariable

192Tvariable

206Avariable

284Cvariable

302Avariable

323Gvariable

326Tvariable

350Tvariable

485Cvariable

497Avariable

522Cvariable

560Avariable

563Avariable

569Cvariable

629Avariable

TTTTCGGCACTTGGTCTGGACTTCTAGGGACTGCTATAAGAATAATTATCCGAGCAGAGCTGGGACAACCAGGCTCCCTTTTAGGAAACG …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type31 records

Wild obs. + sensor1

Museum / vouchered26

Other4

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 1≤1 km 6≤10 km 6

13 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DASSHlocation not on record	7
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	7
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
Cambridge, US	1
PNHSlocation not on record	1

5 institutions · 17 of 26 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Dinophilus taeniatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)