Dinocampus coccinellae

(Schrank, 1802) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Dinocampus

At a glance

Occurrence records1 193

Data sources9

Biological traits0

DNA specimens137

eDNA detections290

Sources9 archives

Databases and archives Dinocampus coccinellae's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 193 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI290 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics137 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 193 records

Environmental DNA4 datasets · 16 countries290 detections

DNA & barcodingBOLD137 specimens

Genome at a glanceGoaT · NCBI≈110 Mbp

01Narrative

Dinocampus coccinellae is a braconid wasp parasite of coccinellid beetles, including the spotted lady beetle, Coleomegilla maculata. D. coccinellae has been described as turning its ladybird host into a temporary "zombie" guarding the wasp cocoon. About 25% of Coleomegilla maculata recover after the cocoon they are guarding matures, although the proportion of other ladybird species which recover is much lower.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding137 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dinocampus coccinellae has left across the world's sequence archives.

At a glance

DNA specimens137

BINs2

Marker genes3

eDNA detections290

Countries18

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus99 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

5Tmostly conserved

22Amostly conserved

238Tmostly conserved

304Cvariable

343Tmostly conserved

604Cvariable

TGTTTTATATTTTTTGTTTGGAATATGGTCAGGGATGTTGGGACTTTCTTTAAGGATAATTATTCGGTTTGAATTATCTACATGTGGCAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes11

BINs2

Most divergent pair10.3%

N.AmericaEuropeS.AmericaOtherAsiaOceania

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCYTB

animal barcoderibosomalmitochondrial

06Genome at a glanceGoaT · NCBI

The complete instruction manual Dinocampus coccinellae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈110 449 871 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Dinocampus coccinellae0.11 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness94.8% BUSCO

08Occurrence & distribution

Record type1 193 records

Wild obs. + sensor1 022

Museum / vouchered171

Origin

Introduced57

Range

Area of Occupancy AOO3 532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 482≤1 km 122≤10 km 186>10 km 67

857 georeferenced · 165 without coordinates

Open the mapobservation + sensor1 022

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 42≤1 km 21≤10 km 24>10 km 2

89 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence171

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MWLRlocation not on record	57
New Zealand Arthropod Collectionlocation not on record	31
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
NHMOlocation not on record	5
Champaign, US	5
Stockholm, SE	4
Landcare Research, New Zealand Arthropod Collectionlocation not on record	4
Auckland, NZ	3
Helsinki, FI	2
Honolulu, US	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Wuzhou, CN	1
WIlocation not on record	1
Museums Victorialocation not on record	1
neflocation not on record	1
South Kensington, GB	1
Copenhagen, DK	1
Western Australian Museumlocation not on record	1

18 institutions · 129 of 171 vouchered records shown · 42 without an institution code

09Environmental DNA290 detections

Where the DNA of Dinocampus coccinellae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found290

Studies independent surveys4

Countries16

Verifiable raw sequence linked115

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 290 detections have coordinates

Open the map16 countries0

Temperate mixed forestAgricultural1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & WoodlandUrban5. Wetlands (inland)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 11.1–17.0

Seasonal swing summer↔winter17.7 °C

Max temp (day)18.9 °C 14.2–21.8

Min temp (night)11.6 °C 7.70–13.8

Precipitation66.4 mm/mo 48.5–90.8

Air humidity60.7 % 57.4–63.7

Moisture balance-47.8 mm/mo -68.2–6.80

Vapour deficit683 Pa 477–827

Wind speed4.00 m/s 2.60–4.80

Cloud cover43.0 % 38.0–52.9

CHELSA 1981–2010, ~9 km grid, at location & month of 219 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dinocampus coccinellae

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 193 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 193 records