Dinia eagrus

Cramer, 1779 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Dinia

At a glance

Occurrence records445

Data sources7

Biological traits0

DNA specimens12

eDNA detections4

Sources7 archives

Databases and archives Dinia eagrus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility445 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF445 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD12 specimens

01Narrative

Dinia eagrus, the scarlet-tipped wasp mimic moth, is a moth of the family Erebidae. The species was first described by Pieter Cramer in 1779.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dinia eagrus has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections4

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

32Gmostly conserved

43Amostly conserved

46Tmostly conserved

49Cmostly conserved

50Cmostly conserved

52Amostly conserved

64Cmostly conserved

81Amostly conserved

82Cvariable

139Tmostly conserved

142Cvariable

238Tmostly conserved

265Tvariable

283Tmostly conserved

284Tmostly conserved

287Tmostly conserved

322Tmostly conserved

368Gvariable

379Amostly conserved

412Avariable

427Tmostly conserved

442Tmostly conserved

477Gvariable

484Tmostly conserved

487Cmostly conserved

490Tmostly conserved

544Cmostly conserved

547Cmostly conserved

568Tmostly conserved

571Tmostly conserved

601Cvariable

616Cmostly conserved

628Avariable

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGTATAGTAGGAACTTCCCTAAGATTATTAATCCGAGCTGAATTAGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes6

BINs2

Most divergent pair4.0%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Delphyre testaceasame family5.9%Delphyre flavicepssame family6.1%Delphyre dizonasame family6.2%Hermierius testaceussame family6.5%Eucereon consortasame family6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type445 records

Wild obs. + sensor313

Museum / vouchered132

Range

Area of Occupancy AOO1 268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 124≤1 km 65≤10 km 36>10 km 17

242 georeferenced · 71 without coordinates

Open the mapobservation + sensor313

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 132 records without

Open the institutions mapphysical evidence132

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	111
The University of the West Indies, Trinidad and Tobagolocation not on record	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	6
Mississippi State, US	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	4

5 institutions · 132 of 132 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Dinia eagrus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 23.2–25.1

Seasonal swing summer↔winter2.50 °C

Max temp (day)26.8 °C 26.1–27.5

Min temp (night)21.3 °C 20.6–22.6

Precipitation296 mm/mo 138–410

Air humidity71.1 % 66.6–74.6

Moisture balance146 mm/mo -9.00–286

Vapour deficit905 Pa 747–983

Wind speed3.30 m/s 1.90–5.10

Cloud cover40.8 % 26.9–44.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)