Dinera grisescens

(Fallén, 1817) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Dinera

At a glance

Occurrence records1 140

Data sources7

Biological traits0

DNA specimens179

eDNA detections196

Sources7 archives

Databases and archives Dinera grisescens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 140 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI196 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics179 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 140 records

Environmental DNA4 datasets · 9 countries196 detections

DNA & barcodingBOLD179 specimens

01Narrative

Dinera grisescens is a species of bristle fly in the family Tachinidae. It is found in North America and Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding179 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dinera grisescens has left across the world's sequence archives.

At a glance

DNA specimens179

BINs3

Marker genes1

eDNA detections196

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus139 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

23Gmostly conserved

58Amostly conserved

106Cmostly conserved

115Cmostly conserved

130Gmostly conserved

145Cmostly conserved

212Cmostly conserved

220Tmostly conserved

226Cmostly conserved

235Tmostly conserved

352Tvariable

368Amostly conserved

370Amostly conserved

400Amostly conserved

406Tmostly conserved

437Amostly conserved

448Tmostly conserved

473Amostly conserved

508Tmostly conserved

550Cmostly conserved

583Amostly conserved

586Tmostly conserved

604Cmostly conserved

616Tmostly conserved

622Cmostly conserved

634Tmostly conserved

646Tmostly conserved

649Gmostly conserved

AACATTATATTTTATTTTCGGGGCATGATCTGGAATAGTAGGAACTTCATTAAGTATATTAATTCGATCAGAATTAGGTCATCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes16

BINs3

Most divergent pair4.4%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Billaea biserialissame family8.7%Ateloglossa cinereasame family8.8%Ateloglossa marginalissame family9.1%Billaea trivittatasame family10.1%Zelia metalissame family10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 140 records

Wild obs. + sensor892

Museum / vouchered238

Cultivated / captive1

Other9

Range

Area of Occupancy AOO2 656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 450≤1 km 187≤10 km 174>10 km 26

837 georeferenced · 55 without coordinates

Open the mapobservation + sensor892

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 36≤1 km 24≤10 km 1

61 georeferenced · 177 without coordinates

Open the institutions mapphysical evidence238

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	64
SLU Artdatabankenlocation not on record	19
NHMOlocation not on record	9
University of Tokyo, Department of Zoologylocation not on record	8
Helsinki, FI	6
DFFW2016location not on record	3
Norwegian Institute for Nature Researchlocation not on record	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
Tampere Museum of Natural Historylocation not on record	2
Gothenburg, SE	1
Ghent, BE	1
Finnish Museum of Natural History, Zoological Museumlocation not on record	1
Universidad Católica de Manizaleslocation not on record	1
South Kensington, GB	1
Royal Saskatchewan Museumlocation not on record	1

15 institutions · 121 of 238 vouchered records shown · 117 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA196 detections

Where the DNA of Dinera grisescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found196

Studies independent surveys4

Countries9

Verifiable raw sequence linked25

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 196 detections have coordinates

Open the map9 countries0

Strawberry Fields5. Wetlands (inland)Forest3. Shrubland|3.4. Temperate Shrubland4. Native Grassland | 4.4. Temperate GrasslandRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 14.2–21.0

Seasonal swing summer↔winter24.9 °C

Max temp (day)24.6 °C 18.5–28.1

Min temp (night)14.2 °C 8.20–15.5

Precipitation58.0 mm/mo 28.7–86.6

Air humidity52.8 % 51.0–60.6

Moisture balance-82.9 mm/mo -119–-41.6

Vapour deficit915 Pa 666–1,231

Wind speed3.00 m/s 2.40–4.00

Cloud cover38.6 % 33.8–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 193 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dinera grisescens

At a glance

Sources7 archives

At a glance

Record type1 140 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 15 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 140 records