Dinera ferina

(Fallén, 1817) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Dinera

At a glance

Occurrence records2 104

Data sources7

Biological traits0

DNA specimens38

eDNA detections103

Sources7 archives

Databases and archives Dinera ferina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 104 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI103 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 104 records

Environmental DNA3 datasets · 9 countries103 detections

DNA & barcodingBOLD38 specimens

01Narrative

Dinera ferina (Fallen) is a species of fly in the family Tachinidae.James E. O'Hara, Hiroshi Shima, & Chuntian Zhang. "Annotated Catalogue of the Tachinidae (Insecta: Diptera) of China." Zootaxa 2190 (2009): 1-236. In June 2018, the Bulletin of Insectology wrote that Dinera ferina was "confirmed to be a parasitoid of larvae of the two Italian Platycerus species, Platycerus caprea (De Geer) and Platycerus caraboides (L.) (Coleoptera Lucanidae)."Scaccini, Davide. “Remarks on the Biology of Dinera Ferina (Diptera Tachinidae) as Parasitoid of the Two Italian Platycerus Species (Coleoptera Lucanidae).” BULLETIN OF INSECTOLOGY, vol. 71, no. 1, pp. 39–43.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dinera ferina has left across the world's sequence archives.

At a glance

DNA specimens38

BINs3

Marker genes1

eDNA detections103

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

1Amostly conserved

22Tmostly conserved

29Tmostly conserved

79Gmostly conserved

82Tmostly conserved

106Tmostly conserved

143Amostly conserved

181Amostly conserved

187Tmostly conserved

211Gmostly conserved

220Tmostly conserved

263Tmostly conserved

289Amostly conserved

325Amostly conserved

343Tmostly conserved

407Cmostly conserved

412Amostly conserved

457Tmostly conserved

500Cmostly conserved

511Amostly conserved

514Cmostly conserved

517Gmostly conserved

541Amostly conserved

607Amostly conserved

610Cmostly conserved

616Cmostly conserved

619Cmostly conserved

634Cvariable

643Gvariable

646Cmostly conserved

AACATTATATTTTATTTTTGGTGCATGATCTGGAATAATCGGTACATCATTAAGTATTTTAATTCGAACTGAATTAGGGCATCCAGAAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes5

BINs3

Most divergent pair10.9%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ateloglossa marginalissame family7.8%Billaea biserialissame family8.8%Ateloglossa cinereasame family8.8%Helina troenesame order10.2%Ochthera mantissame order10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 104 records

Wild obs. + sensor1 940

Museum / vouchered152

Cultivated / captive3

Other9

Range

Area of Occupancy AOO5 260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 776≤1 km 455≤10 km 405>10 km 28

1 664 georeferenced · 276 without coordinates

Open the mapobservation + sensor1 940

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 71≤1 km 60≤10 km 13

144 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence152

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Tokyo, Department of Zoologylocation not on record	25
SLU Artdatabankenlocation not on record	25
MZLUlocation not on record	21
NHMOlocation not on record	14
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	13
Helsinki, FI	11
NMOKlocation not on record	4
Tromsø, NO	3
Tilburg, NL	3
Metsähallituslocation not on record	2
Gothenburg, SE	2
Natural History Museum Rotterdamlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

13 institutions · 125 of 152 vouchered records shown · 27 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA103 detections

Where the DNA of Dinera ferina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found103

Studies independent surveys3

Countries9

Verifiable raw sequence linked59

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 103 detections have coordinates

Open the map9 countries0

Forest1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 14.5–17.4

Seasonal swing summer↔winter19.5 °C

Max temp (day)21.1 °C 18.6–21.8

Min temp (night)13.1 °C 10.7–13.9

Precipitation71.6 mm/mo 57.7–94.5

Air humidity59.3 % 58.1–60.7

Moisture balance-48.3 mm/mo -63.6–-18.5

Vapour deficit778 Pa 696–828

Wind speed3.00 m/s 2.30–4.10

Cloud cover43.8 % 33.3–48.7

CHELSA 1981–2010, ~9 km grid, at location & month of 97 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dinera ferina

At a glance

Sources7 archives

At a glance

Record type2 104 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 13 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 104 records