Dindica polyphaenaria

(Guenée) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Dindica

At a glance

Occurrence records512

Data sources6

Biological traits0

DNA specimens19

eDNA detections23

Sources6 archives

Databases and archives Dindica polyphaenaria's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility512 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF512 records

Environmental DNA1 datasets · 9 countries23 detections

DNA & barcodingBOLD19 specimens

01Narrative

Dindica polyphaenaria Guenée, 1857 è un lepidottero appartenente alla famiglia Geometridae, presente a Taiwan, sull'Himalaya, nel sud-est asiatico e nel Sundaland. Ha un'apertura alare di 45-52 mm. Le larve si nutrono del fogliame giovane delle specie di Litsea. Sono di colore verde foglia con linee subdorsali bianco-gialle e laterali bianche sui segmenti addominali e con linee bianche oscure e oblique tra di essi. È presente anche una stretta striscia ventrale gialla con linee gialle oblique simili tra questa e la linea laterale. L'accoppiamento avviene in una foglia ripiegata e filata.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dindica polyphaenaria has left across the world's sequence archives.

At a glance

DNA specimens19

BINs3

Marker genes5

eDNA detections23

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 77 variable positions, in barcode order

28Avariable

31Cvariable

34Amostly conserved

40Cmostly conserved

46Tmostly conserved

59Tvariable

70Amostly conserved

74Tmostly conserved

79Avariable

81Amostly conserved

82Cvariable

88Tmostly conserved

91Amostly conserved

106Tvariable

127Tvariable

133Tmostly conserved

136Tmostly conserved

139Amostly conserved

154Tmostly conserved

166Avariable

172Cmostly conserved

181Amostly conserved

197Cvariable

200Gvariable

211Avariable

214Amostly conserved

217Avariable

244Avariable

247Tmostly conserved

260Tmostly conserved

268Amostly conserved

283Amostly conserved

304Cmostly conserved

312Gvariable

316Amostly conserved

322Avariable

337Tmostly conserved

343Tvariable

347Cvariable

352Amostly conserved

370Amostly conserved

376Cmostly conserved

385Cmostly conserved

388Avariable

401Tmostly conserved

403Amostly conserved

406Tmostly conserved

412Tmostly conserved

415Tmostly conserved

421Cmostly conserved

433Avariable

465Tmostly conserved

475Tmostly conserved

479Tmostly conserved

487Tmostly conserved

496Amostly conserved

499Amostly conserved

505Tmostly conserved

507Tmostly conserved

508Tmostly conserved

514Tmostly conserved

517Cmostly conserved

532Cmostly conserved

542Tmostly conserved

544Avariable

547Tvariable

548Tvariable

557Tmostly conserved

562Amostly conserved

578Tmostly conserved

581Tvariable

583Amostly conserved

589Cvariable

619Tvariable

631Avariable

634Cvariable

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCCGGAATAATCGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAACCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.6%

Haplotypes7

BINs3

Most divergent pair4.7%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dindica alaopissame genus5.2%Dindica parasame genus5.5%Dindica virescenssame genus5.7%Comostolopsis stillatasame family6.4%Gastrinodes bitaeniariasame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S28SEF1-alpha

animal barcoderibosomalmarker

08Occurrence & distribution

Record type512 records

Wild obs. + sensor263

Museum / vouchered249

Range

Area of Occupancy AOO700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 12≤1 km 5>10 km 2

19 georeferenced · 244 without coordinates

Open the mapobservation + sensor263

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 6≤10 km 1

7 georeferenced · 242 without coordinates

Open the institutions mapphysical evidence249

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
tesrilocation not on record	80
FACTlocation not on record	77
Taiwan Forestry Research Institutelocation not on record	75
Tartu, EE	6
Laboratory of Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japanlocation not on record	3
Naturalis Biodiversity Centerlocation not on record	2
ZSMlocation not on record	2
Natural History Museum of Utahlocation not on record	1
University of Marylandlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

10 institutions · 248 of 249 vouchered records shown · 1 without an institution code

09Environmental DNA23 detections

Where the DNA of Dindica polyphaenaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 19.1–25.0

Seasonal swing summer↔winter4.50 °C

Max temp (day)26.2 °C 21.7–28.5

Min temp (night)19.4 °C 15.2–21.6

Precipitation207 mm/mo 24.3–435

Air humidity67.6 % 63.7–75.6

Moisture balance96.1 mm/mo -66.8–356

Vapour deficit858 Pa 508–1,051

Wind speed1.60 m/s 1.20–6.10

Cloud cover65.8 % 50.2–74.2

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)