Dinaraea aequata

(Erichson, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Dinaraea

At a glance

Occurrence records2 167

Data sources7

Biological traits2

DNA specimens31

eDNA detections47

Sources7 archives

Databases and archives Dinaraea aequata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 167 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI47 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 167 records

Environmental DNA3 datasets · 8 countries47 detections

DNA & barcodingBOLD31 specimens

01Narrative

Dinaraea aequata is a species of rove beetles native to Europe.Fauna EuropaeaNorman H. Joy, , 1932 A Practical Handbook of British Beetles

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dinaraea aequata has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes3

eDNA detections47

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

26Tmostly conserved

475Gmostly conserved

TACCTTATATTTTATTTTTGGAGTATGGGCAGGTATAGTTGGAACTTCTCTAAGTTTATTAATTCGAGCTGAACTAGGAACTCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes8

BIN1

Most divergent pair0.91%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atheta scapularissame family12.2%Atheta hybridasame family12.8%Atheta subtilissame family13.2%Aloconota pseudogregariasame family13.8%Pontomalota opacasame family13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type2 167 records

Wild obs. + sensor1 319

Museum / vouchered822

Cultivated / captive5

Other21

Range

Area of Occupancy AOO5 312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 588≤1 km 395≤10 km 240

1 223 georeferenced · 96 without coordinates

Open the mapobservation + sensor1 319

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 291≤1 km 220≤10 km 166>10 km 27

704 georeferenced · 118 without coordinates

Open the institutions mapphysical evidence822

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	248
NMBU:MINAlocation not on record	80
Helsinki, FI	79
Salzburg, AT	29
Uniwersytet Wrocławskilocation not on record	22
Trondheim, NO	21
Tartu, EE	21
Metsähallituslocation not on record	18
NMOKlocation not on record	17
Tromsø, NO	17
NCMGlocation not on record	14
LSMlocation not on record	13
Tilburg, NL	13
Tallinn, EE	12
IFR-DNFlocation not on record	11
BioFokuslocation not on record	11
State Museum of Nature History, Lvivlocation not on record	10
Copenhagen, DK	10
Muzeum Górnośląskie w Bytomiulocation not on record	9
Kuopio, FI	8
NHMOlocation not on record	8
NTNU-VMlocation not on record	7
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	7
ZSMlocation not on record	7
Natural History Museum Rotterdamlocation not on record	6
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	5
MZLUlocation not on record	5
CBDClocation not on record	3
Olocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Jyväskylä, FI	1
Oulu, FI	1
ZMAAlocation not on record	1
neflocation not on record	1

34 institutions · 718 of 822 vouchered records shown · 104 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA47 detections

Where the DNA of Dinaraea aequata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found47

Studies independent surveys3

Countries8

Verifiable raw sequence linked16

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 47 detections have coordinates

Open the map8 countries0

aus mulmigen verpilzten Rinden einer liegend…Mixed forest, in wood piletien varren pajukkoan Buchen aus Rinden und Bodenstreu gesiebt

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.4 °C 4.10–13.6

Seasonal swing summer↔winter18.0 °C

Max temp (day)15.2 °C 7.70–17.7

Min temp (night)7.00 °C 0.5–9.10

Precipitation63.6 mm/mo 35.7–134

Air humidity59.8 % 57.5–62.1

Moisture balance-20.9 mm/mo -46.9–43.1

Vapour deficit540 Pa 324–651

Wind speed3.00 m/s 2.40–4.10

Cloud cover45.8 % 32.1–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 43 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dinaraea aequata

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type2 167 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 34 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 167 records