Dillenia serrata — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Dilleniales/Dilleniaceae/Dillenia

At a glance

Occurrence records40

Data sources5

Biological traits11

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Dillenia serrata's data was compiled from.

GBIFGlobal Biodiversity Information Facility40 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF40 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height24 m

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment4

Climatewet tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density510 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Dillenia serrata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Lanostane, Tirucallane and Euphane triterpenoids $ Oleanane triterpenoids1

Lupane triterpenoids1

Documented compounds2 total

Compound	Class	Amount	Source
(3S,4aR,6aR,7R,8S,10aR,10bS,12aS)-7-(2-carboxyethyl)-3,7,10a,10b,12a-pentamethyl-8-prop-1-en-2-yl-2,4,4a,6,6a,8,9,10,11,12-decahydro-1H-chrysene-3-carboxylic acid		present	LOTUS
Betulinic Acid		present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dillenia serrata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX215780.1 ↗619 bpIndonesia · 2025

ACGT

CACGAACCTCGCCCCGTGCTAGGGGTCTCGCGTCTCGCTTGCCCCCGCCAAACAACGTACCCCGGCACGAGTCGTGCCAAGGACCCACGA …

Dillenia serrata voucher I Martiansyah s.n. (P7) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

08Occurrence & distribution

Record type40 records

Museum / vouchered40

Range

Area of Occupancy AOO88 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 40 records without

Open the institutions mapphysical evidence40

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Stellenboschlocation not on record	3
Kew, GB	2
Saint Louis, US	1
DOI/NPS, Colonial National Historical Parklocation not on record	1

4 institutions · 7 of 40 vouchered records shown · 33 without an institution code