Dillenia pentagyna

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Dilleniales/Dilleniaceae/Dillenia

At a glance

Occurrence records317

Data sources13

Biological traits28

DNA specimens3

eDNA detections3

Sources13 archives

Databases and archives Dillenia pentagyna's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility317 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS16 compounds

Occurrence & distributionGBIF317 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 26

01Narrative

A small tree with tortuous twigs, Dillenia pentagyna is a member of the family Dilleniaceae, and is found from Sulawesi to South-Central China to India and Sri Lanka. Material from the tree has some minor uses.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Leaf length400 mm

Leaf length max600 mm

Leaf length min200 mm

Leaf width max250 mm

Leaf width min100 mm

Plant height15 m

Seed mass21.27 mg

Seed mass max23.1 mg

Seed mass min19.3 mg

Life cycle & reproduction6

Deciduousnessdeciduous

Flower length max30 mm

Flower length min20 mm

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max700 m

Elevation min200 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density589 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition16 compounds

Compounds documented for Dillenia pentagyna across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile4 classes

Pyrrolizidine alkaloids8

Flavanones2

Dihydroflavonols2

Lupane triterpenoids1

Documented compounds16 total

Tissue Source Quantified only

Compound	Class	Amount	Source
BETULINIC-ACID		9,800 ppm	DukesPhytochem
BETULIN		1,500 ppm	DukesPhytochem

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dillenia pentagyna has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX277646.1 ↗511 bp

ACGT

TAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTATAGAGTTTTCTAAACTCCCAACCCATGTGAACTTACCTTTTGTTGCCTCG …

UNVERIFIED_ORG: Dillenia pentagyna isolate SBB-1514 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dillenia pentagyna carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Sobha, V. & Ramachandran, K. 1980

n 131×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sobha, V. & K. RAMACHANDRAN. 1980. In IOPB chromosome number reports LXVI. Taxon 29: 165–166.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.243 ↗

08Occurrence & distribution

Record type317 records

Wild obs. + sensor193

Museum / vouchered123

Other1

Range

Area of Occupancy AOO832 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 37≤1 km 31≤10 km 30>10 km 6

104 georeferenced · 89 without coordinates

Open the mapobservation + sensor193

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 3≤1 km 7≤10 km 8

18 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence123

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	18
Baroda, IN	12
Beijing, CN	9
Pondicherry, IN	8
Kunming, CN	5
Philadelphia, US	4
Paris, FR	3
MSB-3349location not on record	3
Bronx, US	2
Guilin, CN	2
Kew, GB	2
South Kensington, GB	2
Kagoshima, JP	1
Saint Louis, US	1
University of Stellenboschlocation not on record	1
Fort Worth, US	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Dehra Dun, IN	1
Gujarat Biodiversity Gene Banklocation not on record	1

19 institutions · 77 of 123 vouchered records shown · 46 without an institution code

09Environmental DNA3 detections

Where the DNA of Dillenia pentagyna was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.1 °C 23.1–23.1

Seasonal swing summer↔winter11.9 °C

Max temp (day)30.5 °C

Min temp (night)15.7 °C

Precipitation1.00 mm/mo

Air humidity44.5 %

Moisture balance-123 mm/mo

Vapour deficit1,563 Pa

Wind speed2.60 m/s

Cloud cover14.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)