Dillenia alata

(R.Br. ex DC.) Martelli · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Dilleniales/Dilleniaceae/Dillenia

At a glance

Occurrence records926

Data sources7

Biological traits29

DNA specimens7

eDNA detections4

Sources7 archives

Databases and archives Dillenia alata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility926 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF926 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

ديلنيا مجنحة هي نوع من النباتات يتبع جنس الديلنيا من الفصيلة الديلنية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology9

Fruit width47.5 mm

Leaf length165 mm

Leaf size17 940 mm²

Leaf width92.5 mm

Petiole length3.25 cm

Plant height15 m

Seed length4 mm

Seed mass21 mg

Seed width4 mm

Life cycle & reproduction7

Dispersal typeanimal

Flowering timeynnnnnnnnyyy

Life formtree

Life spanperennial

Pollination syndromebutterfly

Resprouting capacityresprouts

Sex typehermaphrodite

Habitat & environment9

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapeovate

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density540 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dillenia alata has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences2

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496868.1 ↗552 bpAustralia · 2013

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Dillenia alata isolate BATT608-10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type926 records

Wild obs. + sensor451

Museum / vouchered337

Other138

Origin

Native11

Range

Area of Occupancy AOO1 864 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 207≤1 km 54≤10 km 24>10 km 14

299 georeferenced · 152 without coordinates

Open the mapobservation + sensor451

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 36≤1 km 20≤10 km 143>10 km 42

241 georeferenced · 96 without coordinates

Open the institutions mapphysical evidence337

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	103
Smithfield, AU	72
Canberra, AU	33
Museo Entomologico de Leonlocation not on record	32
Palmerston, AU	30
Kew, GB	19
James Cook Townsvillelocation not on record	9
Mount Annan, AU	7
Armidale, AU	4
Zürich, CH	3
Australian Tropical Herbariumlocation not on record	2
Kensington, AU	1
ASUlocation not on record	1
University of Stellenboschlocation not on record	1

14 institutions · 317 of 337 vouchered records shown · 19 without an institution code

09Environmental DNA4 detections

Where the DNA of Dillenia alata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 12.4–22.1

Seasonal swing summer↔winter11.5 °C

Max temp (day)25.6 °C 15.7–27.9

Min temp (night)15.0 °C 8.40–17.9

Precipitation99.4 mm/mo 32.3–263

Air humidity60.5 % 46.8–66.8

Moisture balance29.4 mm/mo -108–135

Vapour deficit844 Pa 559–1,468

Wind speed3.70 m/s 3.40–3.90

Cloud cover18.1 % 13.5–50.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)