Digitaria sanguinalis
(L.) Scop. · speciesAt a glance
Occurrence records118 254
Data sources11
Biological traits66
DNA specimens78
eDNA detections38
Sources11 archives
Databases and archives Digitaria sanguinalis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility118 254 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics78 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources66 traits
Occurrence & distributionGBIF118 254 records
Environmental DNA3 datasets · 13 countries38 detections
DNA & barcodingBOLD · NCBI78 specimens
Genome at a glanceCCDB · GoaT · NCBI1.1 Gbp
01Narrative
Digitaria sanguinalis, la digitaire sanguine, est une espèce de plantes monocotylédones de la famille des Poaceae (Graminées), sous-famille des Panicoideae, originaire de l'Ancien Monde. C'est une plante herbacée annuelle au port décombant ou prostré, aux chaumes pouvant atteindre de 10 à 30 cm de long. L'inflorescence est constituée de racèmes spiciformes groupés en un quasi-verticille à l'extrémité de la tige florale. Comme toutes les Panicoideae, c'est une plante à photosynthèse en C4. La plante est cultivée principalement comme plante fourragère. Elle a été cultivée autrefois pour ses graines en Europe de l'Est. C'est aussi une adventice en Europe occidentale, notamment dans les cultures de maïs en Belgique, mais aussi dans diverses régions du monde où la plante a été introduite. Certaines populations ont été signalées comme résistantes à des herbicides en Australie. Cette espèce est considérée comme envahissante dans certaines régions du monde, notamment aux États-Unis.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology22
Leaf length100 mm
Leaf length max100 mm
Leaf length min30 mm
Leaf mass9.4 mg
⚠ sources differ — AusTraits: 9.4 mg · LEDA: 8.62 mg
Leaf mass per area55.83 g/m2
Leaf size3 226 mm²
⚠ sources differ — AusTraits: 3 226 mm² · LEDA: 290 mm² · GIFT: 290 mm²
Leaf width6 mm
Leaf width max8 mm
Leaf width min4 mm
Plant height0.22 m
⚠ sources differ — GIFT: 0.22 m · AusTraits: 1 m · LEDA: 0.19 m · TRY: 0.425 m
Plant height generative0.375 m
Plant height max1.15 m
Plant height min0.1 m
Seed length2.8 mm
⚠ sources differ — TRY: 2.8 mm · GIFT: 1.8 mm
Seed length max1.8 mm
Seed length min1.8 mm
Seed mass0.5 mg
⚠ sources differ — TRY: 0.5 mg · LEDA: 0.97 mg · GIFT: 0.662 mg
Seed mass max0.6 mg
Seed mass min0.37 mg
Seed volume0.45 mm³
Seed volume max0.45 mm³
Seed volume min0.45 mm³
Life cycle & reproduction17
Deciduousnessdeciduous
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: unspecialized
Flower colourbrown
Flowering endDec
Flowering startJul
Flowering timeyynnnnnnnnny
Life formannual
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprouting capacityresprouts
Seed number600
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 600 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: graminoid-annual
Habitat GIFTLowland
Leaf shapelanceolate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio19.63 g/g
Leaf c429 mg/g
Leaf dry-matter content (LDMC)175 mg/g
Leaf n24.16 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Seed longevity index0.5
Specific leaf area (SLA)34.34 mm²/mg
Other traits4
Diaspore typepart of infructescence
Inflorescencespike
Seeds per fruit101-1000
Shoot orientationascending
05DNA & barcoding78 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Digitaria sanguinalis has left across the world's sequence archives.
At a glance
DNA specimens78
Marker genes12
GenBank sequences10
eDNA detections38
Countries13
The DNA barcodea real sequence read deposited for this species
AGTTTTTGACGCAAGTTGCGCCCGAGGCCTTCTGGTCGAGGGCACGCCTGCCTGGGCGTCACGTCAAAAGACACTCCCAACCCATCCAAG …
Digitaria sanguinalis voucher DWQJM235 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK3★rbcL2★rbcLa★ITS5★ITS1★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Digitaria sanguinalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 134 480 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Digitaria sanguinalis1.13 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy6× hexaploid · measured
Chromosome records18–762n range36median36mode84records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3661×CCDB · slov-fl · CCDB · croinout · CCDB · iber-fl +10
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · croinout — Aboynob, H. II. 1928
CCDB · croinout — Heiser, C. B.& Whitaker, T. W. 1948
CCDB · croinout — Plya, L. 1950
CCDB · croinout — Hubbard, C. E. 1954
CCDB · croinout — de Wet, J. M. J. 1958
CCDB · croinout — Platzer, H. 1962
CCDB · croinout — Gould, F. W. 1963
CCDB · croinout — Tateoka, T. 1965
CCDB · croinout — Fernandes, A. & Queiros, M. 1969
CCDB · croinout — Reeder, J. R. 1971
CCDB · croinout — Chopanov, P. & Yurtsev, B. N. 1976
CCDB · croinout — Prokudin, Yu. N., Vovk, A, G., Petrova, O. A., Ermolenko, E. D. & Vernichenko,Y. 1977
CCDB · croinout — Javurkova, V. 1980
CCDB · croinout — Pogan, E., Wcislo, H., Jzmailow, R., Przywara et al. 1982
CCDB · croinout — Probatova, N. S. & Sokolovskaya, A. P. 1983
CCDB · croinout — Luque, T., Mejas, J. A. & Daz Lifante, Z. 1988
CCDB · croinout — Murin, A. 1978
CCDB · croinout — Aboynob, H. II. 1931
CCDB · croinout — Tischler, G. 1934
CCDB · croinout — Krishnaswamy, N. 1941
CCDB · croinout — Delay, C. 1947
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 544-550. Luque, T., J. A. Mejas & Z. Daz Lifante.Lagascalia15(1): 130-133(1988).
CCDB · poland — Pogan E., Wcis?o H., Izmai?ow R., Przywara L. et al. 1982 b. Further studies in chromosome numbers of Polish Angiosperms. Part XVI. Acta Biol. Cracov. Ser. Bot. 24, 159-189.
CCDB · book-ipcn65 — Tateoka 1965c
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Luque, T., J. A. Mejías & Z. D. Lifante. 1988. Números cromosómicos para la flora Española. 544--550. Lagascalia 15: 130–133.
CCDB · ipcn-api-dl — Pogan, E. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XVI. Acta Biol. Cracov., Ser. Bot. 24: 159–189.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1983. Chromosome numbers in Adoxaceae, Chloranthaceae, Cupressaceae, Juncaceae, Poaceae. Bot. Zhurn. SSSR 68 (12): 1683.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zhang, F. h. Xue, L. y. Wang, J. f. Yun & X. q. Fu. 2000. The chromosome numbers and natural distribution of 38 forage plants in north China. Grassl. China 2000(5): 1–5.
CCDB · ipcn-api-dl — Parfitt, B. D. 1981. ln Chromosome number reports LXXI. Taxon 30: 515–516.
CCDB · ipcn-api-dl — Javurkova, V. 1980. In Chromosome number reports LXIX. Taxon 29: 713–714.
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-ipcn67-71 — REEDER, J.R. 1971. Notes on Mexican grasses IX. Miscellaneous chromosome number.s - 3. Brittonia 23: 105-117.
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov) ; P6lya, L. 1950 ; Hubbard, C.E. 1954 ; de Wet, J.M.J. 1958a ; Platzer, H. 1962 ; Gould, F.W. 1963; Tateoka, T. 1965a ; Fernandes, A. & Queiros, M. 1969 ; Ismail, F.-A. 1971 ; Reeder, J.R. 1971 ; Javflrkova, V. 1980
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov) ; Tischler, G. 1934; Krishnaswamy, N. 1941 ; Delay, C. 1947
CCDB · iapt — IAPT/IOPB Chromosome Data 18
CCDB · Cave1958 — de Wet 1958a
+19 more references
2n 5411×GoaT · Kew Plant DNA C-values Database · CCDB · iapt · CCDB · croinout +4
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · croinout — Covas, G. & Schnack, B. 1947
CCDB · croinout — Nuez, O. 1952
CCDB · croinout — Xu, B. -S., Weng, R. -F. & Zhang, M. -Z. 1992
CCDB · ipcn-api-dl — Xu, B. s., R. f. Weng & M. z. Zhang. 1992. Chromosome numbers of Shanghai plants I. Invest. Stud. Nat. 12: 48–65.
CCDB · book-indian_vol2 — Covas, G. & Schnack, B. 1947 , Nunez, O. 1952
CCDB · kew — Bennett MD, Leitch IJ, Hanson L. 1998. DNA amounts in two samples of angiosperm weeds. Annals of Botany 82 (Supplement A): 121-134.
CCDB · CromoCat 2015 — Probatova, N. S. & Seledets, V. P. (2008). IAPT/IOPB Chromosome Data 5 Taxon 57(2): 553-562
CCDB · CromoCat 2015 — Xu, B.-S., R.-F. Weng & M.-Z. Zhang. (1992). Chromosome numbers of Shangai plants I. Invest. Stud. Nat. (Shangai) 12: 48-65.
2n 286×CCDB · croinout · CCDB · book-ipcn72 · CCDB · book-indian_vol2 +1
CCDB · croinout — Church, G. L. 1929
CCDB · croinout — Heiser, C. B.& Whitaker, T. W. 1948
CCDB · croinout — Mary, T. N. & Malik, C. P. 1971
CCDB · book-ipcn72 — MARY, T.N . & C.P. MALIK. 1971. Cytological studies in some Digitaria species. Genet. Iber. 23: 167-181.
CCDB · book-indian_vol2 — Church, G.L. 1929b; Malik, C.P. & Mary, T.N. 1970b ; Mary, T.N. & Malik, C.P. 1971
CCDB · CromoCat 2015 — Mary, T. N. & Malik, C. P. (1971). Cytological studies in some Digitaria species. Genét. Ibér. 23: 167-181.
2n 182×CCDB · croinout · CCDB · book-indian_vol2
CCDB · croinout — Sharma, A. K., Jhuri, L. 1959
CCDB · book-indian_vol2 — Mehra, P.N. et al. 1968
2n 201×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — REEDER, J.R. 1971. Notes on Mexican grasses IX. Miscellaneous chromosome number.s - 3. Brittonia 23: 105-117.
2n 271×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Faruqi, S. A., Quraish, H. B. & Inamuddin, M. (1987). Studies in Libyan grasses X. Chromosome number and some interesting features Annali di Botanica 45: 75-102
2n 301×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Ismail, F.-A. 1971
2n 401×CCDB · book-ipcn66
CCDB · book-ipcn66 — Gould 1966
2n 761×CCDB · croinout
CCDB · croinout — Sharma, A. K., Jhuri, L. 1959
n 1812×CCDB · croinout · CCDB · iber-fl · CCDB · ipcn-api-dl +2
CCDB · croinout — Parfitt, B. D. 1981
CCDB · croinout — Ward, D. E. & Spellenberg, R. 1988
CCDB · croinout — Devesa, J. A., Ruz, T., Ortega, A., Carrasco, J. P., Viera, M. C. et al. 1990
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). II. Devesa, J. A. & al.Bol. Soc. Brot. ser. 263: 153-205(1990).
CCDB · ipcn-api-dl — Ward, D. E. & R. Spellenberg. 1988. Chromosome counts of angiosperms from New Mexico and adjacent areas. Phytologia 64: 390–398.
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, A. Ortega, J. P. Carrasco, M. C. Viera, R. Torno & J. Pastor. 1990. Contribución al conocimiento cariológico de las Poaceae en Extremadura (Espana)---I. Bol. Soc. Brot., sér. 2 63: 29–66.
CCDB · ipcn-api-dl — Javurkova, V. 1980. In Chromosome number reports LXIX. Taxon 29: 713–714.
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990a). Contribución al conocimiento cariológico de las Poaceae en Extremadura (España). II. Bol. Soc. Brot. 63: 153-205.
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990b). Contribucion al conocimiento cariológico de las Paoceae en Extremadura (España). I. Bol. Soc. Brot. 63: 29-66.
CCDB · CromoCat 2015 — Parfitt, B. D. & N. A. Harriman. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXI]. Taxon 30(2): 515-516.
CCDB · CromoCat 2015 — Ward, D.E. & R.W. Spellenberg. (1988). Chromosome counts of angiosperms from New Mexico and adjacent areas Phytologia 64: 390-398
CCDB · iapt — IAPT/IOPB Chromosome Data 25
n 364×CCDB · croinout · CCDB · ipcn-api-dl · CCDB · CromoCat 2015 +1
CCDB · croinout — Koul, K. K. & Gohil, R. N. 1987
CCDB · ipcn-api-dl — Koul, K. K. & R. N. Gohil. 1987. SOCGI plant chromosome number reports -- IV [i.e., V]. J. Cytol. Genet. 22: 161–162.
CCDB · CromoCat 2015 — Koul, K. K. & Gohil, R. N. (1987). SOCGI plant chromosome number reports -- IV [i.e., V] J. Cytol. Genet. 22: 161-162
CCDB · iapt — IAPT/IOPB Chromosome Data 29
n 143×CCDB · croinout · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · croinout — Malik, C. P. & Mary, T. N. 1970
CCDB · book-ipcn67-71 — MALIK, C.P., & T.N. MARY. 1970. In IOPB chromosome number reports XXVII. Taxon 19: 437-442:"
CCDB · CromoCat 2015 — Malik, C. P. & Mary, T. N. (1970). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXVII]. Taxon 19(3): 439.
n 272×CCDB · croinout · CCDB · ipcn-api-dl
CCDB · croinout — Faruqi, S. A., Quraish, H. B. & Inamuddin, M. 1987
CCDB · ipcn-api-dl — Faruqi, S. A., H. B. Quraish & M. Inamuddin. 1987. Studies in Libyan grasses X. Chromosome number and some interesting features. Ann. Bot. (Rome) 45: 75–102.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
hexaploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness99.2% BUSCO
08Occurrence & distribution
Record type118 254 records
Wild obs. + sensor107 854
Museum / vouchered9 044
Cultivated / captive16
Other1 340
Origin
Native455
Introduced2 788
Range
Area of Occupancy AOO175 404 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy28% within 1 km
≤100 m 15 290≤1 km 9 293≤10 km 64 010>10 km 354
88 947 georeferenced · 18 907 without coordinates
Open the mapobservation + sensor107 854
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 667≤1 km 1 389≤10 km 1 995>10 km 230
4 281 georeferenced · 4 763 without coordinates
Open the institutions mapphysical evidence9 044
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 7
7 georeferenced · 9 without coordinates
Open the mapnot free-living16
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions262 of 467 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 315 |
| Uniwersytet Wrocławskilocation not on record | 282 |
| MeiseBGlocation not on record | 230 |
| Philadelphia, US | 227 |
| Berlin, DE | 190 |
| LDlocation not on record | 182 |
| Wuzhou, CN | 179 |
| International Salmonella Centre (W.H.O.)location not on record | 162 |
| Moscow State Universitylocation not on record | 158 |
| Pretoria, ZA | 151 |
| Québec, CA | 150 |
| BFLlocation not on record | 128 |
| Chongqing Museumlocation not on record | 127 |
| Davis, US | 124 |
| Adelaide, AU | 123 |
| Museo Entomologico de Leonlocation not on record | 122 |
| Madison, US | 122 |
| Saint Louis, US | 113 |
| Bloomington, US | 112 |
| Mount Annan, AU | 108 |
| SLU Artdatabankenlocation not on record | 107 |
| Ann Arbor, US | 93 |
| Riverside, US | 89 |
| Canberra, AU | 85 |
| ASUlocation not on record | 79 |
| Auckland, NZ | 72 |
| Guangzhou, CN | 68 |
| University of Stellenboschlocation not on record | 67 |
| Barcelona, ES | 63 |
| València, ES | 62 |
| Adam Mickiewicz University in Poznańlocation not on record | 61 |
| Claremont, US | 60 |
| College Park, US | 58 |
| Williamsburg, US | 58 |
| Hobart, AU | 56 |
| Chapel Hill, US | 53 |
| WTUlocation not on record | 53 |
| Bern, CH | 51 |
| Helsinki, FI | 50 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 50 |
| Christchurch, NZ | 49 |
| MAlocation not on record | 47 |
| Bronx, US | 47 |
| St. Paul, US | 47 |
| San Isidro, AR | 46 |
| BDBClocation not on record | 45 |
| Oskarshamn, SE | 45 |
| Olocation not on record | 44 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 43 |
| South Kensington, GB | 43 |
| Beijing, CN | 42 |
| Wellington, NZ | 42 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 42 |
| Durango, MX | 41 |
| Flagstaff, US | 40 |
| Corvallis, US | 40 |
| Salzburg, AT | 37 |
| Badajoz, ES | 37 |
| Canadian Department of Agriculturelocation not on record | 37 |
| New Haven, US | 36 |
| Uniwersytet Jagiellońskilocation not on record | 35 |
| Fort Worth, US | 34 |
| Kew, GB | 34 |
| San Diego, US | 33 |
| Brisbane, AU | 33 |
| Burlington, US | 32 |
| Pullman, US | 32 |
| BClocation not on record | 32 |
| Santa Barbara, US | 32 |
| Montréal, CA | 32 |
| University of New Hampshirelocation not on record | 31 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 30 |
| GJOlocation not on record | 30 |
| Mexico City, MX | 29 |
| Entomological Society of Latvialocation not on record | 29 |
| Logan, US | 28 |
| Denver, US | 28 |
| CICYTEXlocation not on record | 28 |
| Cape Town, ZA | 28 |
| Nanjing, CN | 27 |
| Córdoba, ES | 27 |
| Austin, US | 27 |
| TAIElocation not on record | 26 |
| San Luis Obispo, US | 25 |
| Görlitz, DE | 25 |
| Moscow, US | 25 |
| Chadron, US | 24 |
| NSMKlocation not on record | 24 |
| Guilin, CN | 24 |
| EL PASO, US | 23 |
| Wlocation not on record | 23 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 23 |
| College of the Atlantic, Museumlocation not on record | 22 |
| Phoenix, US | 22 |
| Yunnan Universitylocation not on record | 22 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 21 |
| Mlocation not on record | 20 |
| Yangling, CN | 20 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 20 |
| Wuhan, CN | 20 |
| Vitoria, ES | 19 |
| BRNUlocation not on record | 19 |
| Uppsala, SE | 19 |
| Kensington, AU | 19 |
| UFERSAlocation not on record | 19 |
| Universidade Federal de Pelotaslocation not on record | 19 |
| Ciudad Autónoma de Buenos Aires, AR | 19 |
| Pittsburg, US | 19 |
| Salamanca, ES | 18 |
| Armidale, AU | 18 |
| Provincia di Livornolocation not on record | 18 |
| Chengdu, CN | 18 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 18 |
| Córdoba, AR | 17 |
| Jackson, US | 17 |
| Tampa, US | 16 |
| DOI/NPS, Greenbelt Parklocation not on record | 16 |
| Baroda, IN | 16 |
| Hangzhou, CN | 16 |
| Taipei, TW | 15 |
| Rotorua, NZ | 15 |
| GMBAlocation not on record | 15 |
| Chengdu, CN | 15 |
| Dresden, DE | 14 |
| Lubbock, US | 14 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 14 |
| Brussel, BE | 14 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 14 |
| Albuquerque, US | 14 |
| Mexico City, MX | 14 |
| Torreón, MX | 13 |
| BAYLUlocation not on record | 13 |
| Green Bay, US | 13 |
| Zhengzhou, CN | 13 |
| Awka, NG | 13 |
| Allentown, US | 13 |
| ENTClocation not on record | 12 |
| Columbia, US | 12 |
| Montecillo, Texcoco, MX | 12 |
| Uniwersytet Warszawskilocation not on record | 12 |
| Natural History Museum Rotterdamlocation not on record | 12 |
| Acadia Universitylocation not on record | 12 |
| Knoxville, US | 12 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 11 |
| Culiacán, MX | 11 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 11 |
| Arcata, US | 11 |
| UFRPElocation not on record | 11 |
| Chapingo, MX | 11 |
| PRClocation not on record | 11 |
| La Paz, MX | 11 |
| Zürich, CH | 11 |
| Université Lavallocation not on record | 11 |
| Seoul, KR | 11 |
| Minia, EG | 10 |
| Provo, US | 10 |
| Victoria, CA | 10 |
| Clemson, US | 10 |
| Durban, ZA | 10 |
| Missoula, US | 10 |
| Santa Cruz, US | 10 |
| Dekalb, US | 10 |
| Staten Island, US | 9 |
| Morgantown, US | 9 |
| Peking Universitylocation not on record | 9 |
| US | 9 |
| Guangzhou, CN | 9 |
| CASlocation not on record | 9 |
| Tilburg, NL | 9 |
| Central China Normal Universitylocation not on record | 9 |
| Portland, US | 9 |
| McWane Science Centerlocation not on record | 9 |
| Los Angeles, US | 9 |
| Guasave, MX | 9 |
| Millersville, US | 9 |
| Hermosillo, MX | 8 |
| KIWElocation not on record | 8 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 8 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 8 |
| CJBGlocation not on record | 8 |
| Norfolk, US | 8 |
| Xiamen, CN | 8 |
| IDElocation not on record | 8 |
| ISAlocation not on record | 7 |
| Bangkok, TH | 7 |
| Zürich, CH | 7 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 7 |
| Alicante, ES | 7 |
| Keene State Universitylocation not on record | 7 |
| Oulu, FI | 7 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 7 |
| Northridge, US | 7 |
| Museum of the Rockieslocation not on record | 7 |
| Hudson, US | 6 |
| Loja, EC | 6 |
| Universidad Nacional de Colombia (UNAL)location not on record | 6 |
| Paris, FR | 6 |
| Cape Town, ZA | 6 |
| Parkville, AU | 6 |
| Ciudad de México, MX | 6 |
| US | 6 |
| QVMAGlocation not on record | 6 |
| Vancouver, CA | 6 |
| Austin, US | 6 |
| USFSlocation not on record | 6 |
| Shenyang Agricultural Universitylocation not on record | 6 |
| Boise, US | 6 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 6 |
| Pamplona, ES | 5 |
| Coimbra, PT | 5 |
| Pocatello, US | 5 |
| SZUlocation not on record | 5 |
| GZUlocation not on record | 5 |
| Porrentruy, CH | 5 |
| Salvador, BR | 5 |
| University of Alberta Museumslocation not on record | 5 |
| University of Guelph, OAC Herbariumlocation not on record | 5 |
| Ciudad de México, MX | 5 |
| Madrid, ES | 5 |
| Turku, FI | 5 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 5 |
| Lincoln, US | 5 |
| Angwin, US | 5 |
| Granada, ES | 5 |
| Tsukuba, JP | 5 |
| Istituto Agrario Castelnuovolocation not on record | 5 |
| UGentlocation not on record | 5 |
| Irvine, US | 5 |
| GB | 5 |
| Valdosta State Universitylocation not on record | 5 |
| Castelar, AR | 4 |
| Fredericton Stock Culture Collectionlocation not on record | 4 |
| Tapachula, MX | 4 |
| Shanghai, CN | 4 |
| Bend, US | 4 |
| Centro de Investigación Regional Norte Centro, Campo Experimental La Campana, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuariaslocation not on record | 4 |
| UIBlocation not on record | 4 |
| Taipei, TW | 4 |
| Shanghai, CN | 4 |
| San Angelo, US | 4 |
| UnBlocation not on record | 4 |
| Jaén, ES | 4 |
| QAUlocation not on record | 4 |
| The University of Arizonalocation not on record | 4 |
| Denton, US | 4 |
| KMCClocation not on record | 4 |
| Tempe, US | 4 |
| Whitewater, US | 4 |
| Museo Achille Folettolocation not on record | 4 |
| BSBIlocation not on record | 4 |
| Batemans Bay, AU | 4 |
| Nijmegen, NL | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Jishou Universitylocation not on record | 4 |
| Podgorica, ME | 4 |
| Mexico City, MX | 4 |
| Oswego, US | 4 |
| Zapopan, MX | 4 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 4 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 4 |
| Wuhan, CN | 4 |
| Tianjin Natural History Museumlocation not on record | 4 |
| Forest Herbarium Ibadan (FHI)location not on record | 4 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| Spearfish, US | 4 |
| Davenport, US | 4 |
| KMNlocation not on record | 3 |
| Fundación Miguel Lillolocation not on record | 3 |
| NoColllocation not on record | 3 |
| Herbarium of South China Botanical Gardenlocation not on record | 3 |
| Chongqing, CN | 3 |
| Fayetteville, US | 3 |
| Nagasaki University - Fisherieslocation not on record | 3 |
| Karlsruhe, DE | 3 |
| Kyoto Universitylocation not on record | 3 |
| San Jose, US | 3 |
| San Luis Potosí, MX | 3 |
| Chicago, US | 3 |
| Beijing, CN | 3 |
| University of Wisconsinlocation not on record | 3 |
| Waverly, US | 3 |
| State Herbarium of South Australialocation not on record | 3 |
| AUT001location not on record | 3 |
| Bozeman, US | 3 |
| GAlocation not on record | 3 |
| Changsha, CN | 3 |
| Museu Paraense Emílio Goeldilocation not on record | 3 |
| Altos de Pipe, VE | 3 |
| Bourges, FR | 3 |
| Lausanne, CH | 3 |
| Rishon Le Zion, IL | 3 |
| Departamento de Sistematica e Ecologialocation not on record | 3 |
| Pamplona, ES | 3 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 3 |
| Trondheim, NO | 3 |
| Bergen, NO | 3 |
| Cambridge, US | 3 |
| UFBAlocation not on record | 3 |
| Palmerston North, NZ | 3 |
| Laboratory of Palaeontologylocation not on record | 3 |
| Instituto de Investigação Científica Tropicallocation not on record | 3 |
| Severin-McDaniel Insect Collectionlocation not on record | 3 |
| Emporia, US | 3 |
| Lord Fairfax Community Collegelocation not on record | 3 |
| China Agricultural Universitylocation not on record | 3 |
| ZRC-SAZUlocation not on record | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| Hazara Universitylocation not on record | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| BGPAlocation not on record | 2 |
| Blumenau, BR | 2 |
| Taipei, TW | 2 |
| Caldwell, US | 2 |
| Henderson, US | 2 |
| New Mexico State Universitylocation not on record | 2 |
| Asheville, US | 2 |
| Fairfax, US | 2 |
| US | 2 |
| CZE122location not on record | 2 |
| Little Rock, US | 2 |
| Long Beach, US | 2 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 2 |
| Durham, US | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| JBSlocation not on record | 2 |
| Universität Tübingenlocation not on record | 2 |
| Palmerston, AU | 2 |
| La Trobe Universitylocation not on record | 2 |
| Namur, BE | 2 |
| Dover, US | 2 |
| University of South Carolina Salkehatchielocation not on record | 2 |
| Sevilla, ES | 2 |
| Universidade Federale do Rio Grande do Sullocation not on record | 2 |
| Bratislava, SK | 2 |
| Stockholm, SE | 2 |
| WNNUlocation not on record | 2 |
| Xinxiang, CN | 2 |
| Chicago, US | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| University of North Carolina at Pembrokelocation not on record | 2 |
| Springfield, US | 2 |
| New Brunswick, US | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Weber State Universitylocation not on record | 2 |
| Guatemala City, GT | 2 |
| EEZA-CSIClocation not on record | 2 |
| Université de Strasbourglocation not on record | 2 |
| BAlocation not on record | 2 |
| Maryland Department of Natural Resourceslocation not on record | 2 |
| Kingston, US | 2 |
| TROMlocation not on record | 2 |
| University of Tennessee at Chattanoogalocation not on record | 2 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 2 |
| Yaoundé, CM | 2 |
| Aarhus, DK | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| Lanzhou, CN | 2 |
| Xian, CN | 2 |
| Universidad del Quindío (UniQuindío)location not on record | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| MCNAMlocation not on record | 2 |
| Cheney, US | 2 |
| Beijing Natural History Museumlocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Cochabamba, BO | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| Philadelphia, US | 1 |
| Clarksville, US | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| UEMAlocation not on record | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Corrientes, AR | 1 |
| Universidad Nacional de Misiones- CONICETlocation not on record | 1 |
| Linares, MX | 1 |
| Mérida, MX | 1 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Orem, US | 1 |
| Johnson City, US | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Bothell, US | 1 |
| Miami, US | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| Richmond, US | 1 |
| UNESP-ISlocation not on record | 1 |
| South African National Parks, Scientific Services, Kruger National Parklocation not on record | 1 |
| Edinburgh, GB | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| University of Wisconsinlocation not on record | 1 |
| Grassland Research Institute, Chinese Academy of Agricultural Scienceslocation not on record | 1 |
| Anchorage, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Fribourg, CH | 1 |
| Irkutsk State Universitylocation not on record | 1 |
| Brasília, BR | 1 |
| Sant Julià de Lòria, AD | 1 |
| Henderson State Universitylocation not on record | 1 |
| Monastir, TN | 1 |
| IPE-CSIClocation not on record | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Elikins, US | 1 |
| Brookings, US | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Fredericksburg, US | 1 |
| BioFokuslocation not on record | 1 |
| Tartu, EE | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Philadelphia, US | 1 |
| Turlock, US | 1 |
| Macomb, US | 1 |
| St. Augustine, TT | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| KNAMlocation not on record | 1 |
| GHPG$location not on record | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| Madrid, ES | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 1 |
| Zacatecas, MX | 1 |
| Kunming, CN | 1 |
| Banyoles, ES | 1 |
| Edmonton, CA | 1 |
| CJBNlocation not on record | 1 |
| Stephenville, US | 1 |
| LINUlocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Firenze, IT | 1 |
| Göteborg, SE | 1 |
| Gijón, ES | 1 |
| Russellville, US | 1 |
| Kirksville, US | 1 |
| Plocation not on record | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| LGlocation not on record | 1 |
| Llocation not on record | 1 |
| Grand Junction, US | 1 |
| UDESC-CAVlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Tromso University Museumlocation not on record | 1 |
| Ensenada, MX | 1 |
| ESP119location not on record | 1 |
| Due West, US | 1 |
| Tuscaloosa, US | 1 |
| HUN003location not on record | 1 |
| Santarém, BR | 1 |
| Tacoma, US | 1 |
| Ashland, US | 1 |
| Nanjing, CN | 1 |
| South China Normal Universitylocation not on record | 1 |
| FJFClocation not on record | 1 |
| Chicago, US | 1 |
| UFMSlocation not on record | 1 |
| Xining, CN | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
467 institutions · 8 365 of 9 044 vouchered records shown · 622 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA38 detections
Where the DNA of Digitaria sanguinalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found38
Studies independent surveys3
Countries13
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 38 detections have coordinates
Open the map13 countries0
Grasslanddamp, disturbed road edge|granitic|Phenology…Reservoir damsroadside weed
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.2 °C 14.9–23.6
Seasonal swing summer↔winter13.6 °C
Max temp (day)22.7 °C 19.5–28.2
Min temp (night)15.2 °C 10.2–19.5
Precipitation83.4 mm/mo 26.4–189
Air humidity59.5 % 55.3–66.1
Moisture balance-35.5 mm/mo -103–43.5
Vapour deficit867 Pa 687–1,141
Wind speed3.30 m/s 2.40–4.10
Cloud cover39.4 % 15.5–53.2
CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.