Digitalis viridiflora

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Digitalis

At a glance

Occurrence records126

Data sources11

Biological traits10

DNA specimens4

eDNA detections0

Sources11 archives

Databases and archives Digitalis viridiflora's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility126 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS46 compounds

Occurrence & distributionGBIF126 records

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 56

01Narrative

Digitalis viridiflora is a species of flowering plant commonly called green foxglove in family Plantaginaceae. It is a perennial species with greenish-yellow flowers produced on stems that grow 60 to 80cm tall. It is native to the Balkans. It is found growing in woodlands and heaths.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.26 mg

Seed mass max0.54 mg

Seed mass min0.12 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Habitat & environment4

Aquaticterrestrial

Climatetemperate

Growth formherb

⚠ sources differ — GIFT: herb · TRY: herb/shrub

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: non-woody

03Chemical composition46 compounds

Compounds documented for Digitalis viridiflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cadinane sesquiterpenoids18

Cardenolides17

Cinnamic acids and derivatives3

Anthraquinones and anthrones3

Camphane monoterpenoids1

Documented compounds46 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-beta-Caryophyllene	present	NPASS
(1R,2S,4R,4aS,8aR)-4,7-dimethyl-1-propan-2-yl-3,4,4a,5,6,8a-hexahydro-2H-naphthalene-1,2-diol	present	NPASS
(1R,4S,4aR,8aS)-4,7-dimethyl-1-propan-2-yl-1,3,4,4a,5,8a-hexahydronaphthalene-2,6-dione	present	NPASS
(1S,2R,4R,5S)-5-(hydroxymethyl)-1,7,7-trimethylbicyclo[2.2.1]heptan-2-ol	present	NPASS
(1S,2R,4S,5R)-5-(hydroxymethyl)-6,6-dimethylbicyclo[2.2.1]heptan-2-ol	present	NPASS
(1S,3aS,4R,8aS)-1,7-dimethyl-4-propan-2-yl-1,3,3a,4,5,8a-hexahydroazulene-2,6-dione	present	NPASS
(1S,6S,7R,9S,12S)-9-hydroxy-3,7-dimethyl-12-propan-2-yl-10,11-dioxatricyclo[7.2.1.01,6]dodec-2-en-4-one	present	NPASS
(3aR,5R,5aS,9aR)-3a-[(3aR,5R,5aS,9aR)-1,5,8-trimethyl-2,7-dioxo-5,5a,6,9a-tetrahydro-4H-benzo[e][1]benzofuran-3a-yl]-1,5,8-trimethyl-5,5a,6,9a-tetrahydro-4H-benzo[e][1]benzofuran-2,7-dione	present	NPASS
(3aS,5R,5aS,9aR)-1,5,8-trimethyl-3a,4,5,5a,6,9a-hexahydrobenzo[e][1]benzofuran-2,7-dione	present	NPASS
(4aR,5S,8S,8aR)-4a,5-dihydroxy-3,8-dimethyl-5-propan-2-yl-1,7,8,8a-tetrahydronaphthalene-2,6-dione	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Digitalis viridiflora has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAY591262.1 ↗620 bp

ACGT

CGTGAACATGTTTTTAACTTGAATGGTGACTCAATAGGATGCGCAAGCCTTCTGTTTAGATCACCATGCTTGCTTGACGTTTGCGTCTTG …

Digitalis viridiflora internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Digitalis viridiflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 56 n = 28

Ploidypolyploid inferred

Chromosome records56–562n range56median56mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 569×CCDB · fl-europaea · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2

CCDB · fl-europaea — Lungeanu, 1967

CCDB · ipcn-api-dl — OLGUN, G. 1979. Investigation on the comparative karyology and embryology (embryo sac and endosperm development) of Digitalis viridiflora Lindl. and D. lutea L. Rev. Fac. Sci. Univ. Istanbul, Ser. B, Sci. Nat. 44: 1–22.

CCDB · ipcn-api-dl — Olgon, G. 1979. In IOPB chromsome number reports LXV. Taxon 28:631.

CCDB · ipcn-api-dl — Andreev, V. N. 1981. In Chromosome number reports LXX. Taxon 30: 74–75.

CCDB · book-ipcn67-71 — TARNAVSCHI, I. T., & I. LUNGEANU. 1967. Contributii la studiul cariologic al unor specii din genul Digitalis L. Univ. Babes-Bolyai din Cluj, Grad. Bot. Contr. 1967: 425-430.

CCDB · book-fedorov — Buxton, Newton 1928

CCDB · book-fedorov — Huskins 1928

CCDB · book-fedorov — Buxton, Dark 1934

CCDB · book-atlas-flowering-plants — Buxton & N. 1928

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type126 records

Wild obs. + sensor62

Museum / vouchered61

Cultivated / captive3

Origin

Native1

Introduced3

Range

Area of Occupancy AOO400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 22≤1 km 18≤10 km 7>10 km 1

48 georeferenced · 14 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 5≤1 km 1

6 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence61

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	21
LDlocation not on record	13
Adam Mickiewicz University in Poznańlocation not on record	4
Moscow State Universitylocation not on record	3
School of Biology, Aristotle University of Thessalonikilocation not on record	3
Wlocation not on record	2
València, ES	2
BRNUlocation not on record	1
MAlocation not on record	1
National Museum of Natural History, Bulgarian Academy of Scienceslocation not on record	1
GJOlocation not on record	1
Salamanca, ES	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Uppsala, SE	1
PRClocation not on record	1
BG-NMNHSlocation not on record	1
MeiseBGlocation not on record	1
Frankfurt am Main	1

18 institutions · 59 of 61 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)