Digera muricata

(L.) Mart. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Digera

At a glance

Occurrence records642

Data sources9

Biological traits23

DNA specimens6

eDNA detections5

Sources9 archives

Databases and archives Digera muricata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility642 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF642 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Digera muricata (L.) Mart. – gatunek roślin z rodziny szarłatowatych reprezentujący monotypowy rodzaj Digera. Występuje w północno-wschodniej i wschodniej Afryce – od Egiptu po Tanzanię i Madagaskar, w południowej i wschodniej Azji – na Półwyspie Arabskim, od Pakistanu poprzez Indie po Mjanmę, na wyspach Indonezji, we wschodnich Chinach. Jako gatunek introdukowany stwierdzony został także w Europie – w Niemczech. Rośnie jako chwast w uprawach, w miejscach nawadnianych, na brzegach wód, w zaburzonych, wilgotnych miejscach.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height0.7 m

Plant height max1.52 m

Plant height min0.305 m

Seed mass4.4 mg

Seed mass max4.4 mg

Seed mass min4.4 mg

Life cycle & reproduction4

Dispersal typewind

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 800 m

Elevation min500 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTmany kinds of habitats, mostly on disturbed and waste ground, cultivation, Acacia-Commiphora bushland, seasonal streambeds, eroded hillsides, coastal bushland

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Digera muricata has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences7

eDNA detections5

Countries4

The DNA barcodea real sequence read deposited for this species

ITSLT993003.1 ↗686 bpKenya

ACGT

GTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCAGCGAACACGTTTATCATGAGTGGGGTTGGTGCGCTTT …

Digera muricata 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, ITS2 and 28S rRNA gene (partial), isolate AC1180

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL★rbcLa★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Digera muricata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records12–342n range18median18mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 187×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +2

CCDB · book-ipcn65 — Sharma & B. 1965

CCDB · ipcn-api-dl

CCDB · book-ipcn66 — Sharma & Banik 1965

CCDB · book-ipcn67-71 — MITRA, K., & N. DATTA. 1967. In IOPB chromosome number reports XIII. Taxon 16: 445-461.

CCDB · book-indian_vol1 — Pal, M. 1964

CCDB · book-indian_vol1 — Mitra, K. & Datta, N. 1967; Mittra, R, 1971

CCDB · book-indian_vol1 — Sen, S. 1956 ; Malik, C. P. 1960b ; Tha- kur, V. 1964; Sharma, A. K. & Banik, M. 1965; Baquar, S. R. et al. 1966; Gill, B. S. & Vasudeva, S. 1970b; Pal. M. (Khoshoo, T. N. 1979)

2n 122×CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Joshi & Rao (Tischler, G. 1935-1936) ~ Puri, V. & Singh, N. B. 1935 (D. 1955)

CCDB · book-atlas-flowering-plants — Puri & S. 1935

2n 171×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sanjappa, M. 1978. In IOPB chromosome number reports LXI. Taxon 27: 375–392.

2n 341×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Sanjappa, M. 1978

n 97×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +1

CCDB · book-ipcn65 — Sharma & B. 1965

CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.

CCDB · ipcn-api-dl — Zaidi, S. 2003. Effects of electromagnetic fields (created by high tension lines) on the indigenous floral biodiversity in the vicinity of Karachi-I: studies on PMC meiosis, meiotic products and pollen fertility. Pakistan J. Bot. 35(5): 743–755.

CCDB · book-ipcn66 — Baquar et al. 1966

CCDB · book-ipcn67-71 — MITRA, K., & N. DATTA. 1967. In IOPB chromosome number reports XIII. Taxon 16: 445-461.

CCDB · book-ipcn67-71 — GILL, B.S., & S. VASUDEVA. 1970. Cytological studies in some members of Amaranthaceae. Curr. Sci. 39: 445-446.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type642 records

Wild obs. + sensor393

Museum / vouchered229

Other20

Origin

Native2

Range

Area of Occupancy AOO1 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 72≤1 km 53≤10 km 14>10 km 5

144 georeferenced · 249 without coordinates

Open the mapobservation + sensor393

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 3≤1 km 46≤10 km 91>10 km 12

152 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence229

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
QAUlocation not on record	122
Berlin, DE	17
GMBAlocation not on record	13
Kew, GB	9
Baroda, IN	8
Pondicherry, IN	7
Stockholm, SE	7
Uppsala, SE	4
Uniwersytet Śląski w Katowicachlocation not on record	4
Saint Louis, US	3
Taipei, TW	2
TAIElocation not on record	2
TAFORI-LSRClocation not on record	2
Wlocation not on record	1
Frankfurt am Main	1
University of Stellenboschlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
CJBGlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
LDlocation not on record	1
Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record	1
Moscow State Universitylocation not on record	1
Plocation not on record	1
Bloomington, US	1

25 institutions · 212 of 229 vouchered records shown · 17 without an institution code

09Environmental DNA5 detections

Where the DNA of Digera muricata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.2 °C 26.4–27.9

Seasonal swing summer↔winter16.3 °C

Max temp (day)33.1 °C 32.3–33.9

Min temp (night)20.5 °C 18.5–22.5

Precipitation20.1 mm/mo 4.30–35.8

Air humidity51.2 % 47.5–55.0

Moisture balance-133 mm/mo -153–-114

Vapour deficit1,748 Pa 1,686–1,809

Wind speed2.60 m/s

Cloud cover16.4 % 15.8–17.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)