Didymella fabae

G.J.Jellis & Punith. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Didymellaceae/Didymella

At a glance

Occurrence records42

Data sources11

Biological traits0

DNA specimens7

eDNA detections10

Sources11 archives

Databases and archives Didymella fabae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility42 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS16 compounds

Occurrence & distributionGBIF42 records

Environmental DNA3 datasets · 1 countries10 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceGoaT · NCBI≈49 Mbp

01Narrative

DISPLAYTITLE Ascochyta fabae f.sp. lentis is a plant pathogen that causes ascochyta blight on lentil.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition16 compounds

Compounds documented for Didymella fabae across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Carboline alkaloids14

Mycosporine and Mycosporine-like amino acids1

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
(1S)-1-[(1S)-6-bromo-2-methyl-1,3,4,9-tetrahydropyrido[3,4-b]indol-1-yl]-2-(4-methylphenyl)ethanamine	present	NPASS
(4R)-11-bromo-3-methyl-4-(methylsulfanylmethyl)-1,3,6-triazatetracyclo[7.6.1.05,16.010,15]hexadeca-5,7,9(16),10(15),11,13-hexaen-12-ol	present	NPASS
(4R)-11-bromo-3-methyl-4-[[(R)-methylsulfinyl]methyl]-1,3,6-triazatetracyclo[7.6.1.05,16.010,15]hexadeca-5,7,9(16),10(15),11,13-hexaen-12-ol	present	NPASS
(4R)-4-[[(5R)-5-hydroxy-5-(hydroxymethyl)-2-methoxy-3-oxocyclohexen-1-yl]amino]-5-[(2R,3S,4R,5R,6S)-4,5,6-trihydroxy-2-(hydroxymethyl)oxan-3-yl]oxypentanamide	present	LOTUS
5-bromo-1-[(1S)-1-(methylamino)-2-[(R)-methylsulfinyl]ethyl]-9H-pyrido[3,4-b]indol-6-ol	present	NPASS
5-Bromo-9-methyl-9h-b-carbolin-6-ol	present	NPASS
6-Bromo-1-(3,4-Dihydro-2H-Pyrrol-5-Yl)-9H-Pyrido(3,4-B)Indole	present	NPASS
Eudistomidin A	present	NPASS
Eudistomidin C	present	NPASS
Eudistomidin G	present	NPASS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Didymella fabae has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes1

GenBank sequences10

eDNA detections10

Countries4

The DNA barcodea real sequence read deposited for this species

ITSOQ220962.1 ↗404 bpAustria

ACGT

GCCCGCCGATTGGACAATTTAAACCATTTGCAGTTGCAATCAGCGTCTGAAAAAACATAATAGTTACAACTTTCAACAACGGATCTCTTG …

Ascochyta fabae isolate VuJo22 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Didymella fabae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈49 417 499 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Didymella fabae0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type42 records

Wild obs. + sensor26

Museum / vouchered16

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 8≤1 km 2≤10 km 16

26 georeferenced

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 16 records without

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	15
Kew, GB	1

2 institutions · 16 of 16 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Didymella fabae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys3

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

Vicia faba

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.65 5.00–6.30

Conductivity22.5 µS/cm 20.0–25.0

Organic carbon1.55 % 0.71–2.39

Water content5.85 %

Nitrate-N3.00 mg/kg

Clay7.71 % 3.93–11.5

Sand87.6 % 81.2–94.1

Depth0.1 m 0–0.2

SoilChromosolsTenosols

2 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 13.0–14.6

Seasonal swing summer↔winter10.7 °C

Max temp (day)18.0 °C 17.1–18.0

Min temp (night)10.7 °C 8.50–10.7

Precipitation89.9 mm/mo 89.9–117

Air humidity56.1 % 56.1–59.0

Moisture balance-3.00 mm/mo -3.00–30.4

Vapour deficit724 Pa 616–724

Wind speed4.10 m/s 2.90–4.10

Cloud cover9.40 % 7.90–9.40

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)