Didymascella thujina

(E.J.Durand) Maire · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Hemiphacidiaceae/Didymascella

At a glance

Occurrence records66

Data sources5

Biological traits0

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Didymascella thujina's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility66 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF66 records

DNA & barcodingNCBIsequences

01Narrative

Didymascella thujina is an ascomycete fungus in the family Helotiaceae. D. thujina causes cedar leaf blight (also known as Keithia blight or Keithia leaf blight), a leaf disease, on western red cedar (Thuja plicata) and white cedar (T. occidentalis).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Didymascella thujina has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSKT875766.1 ↗359 bp

ACGT

ATCGATGAAGACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCAGTGAATCATCGAATCTTTGGACGCACATTGCGCCCCTT …

Didymascella thujina isolate Dd2_3b_800.SCF 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type66 records

Wild obs. + sensor17

Museum / vouchered49

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 9≤1 km 1≤10 km 6

16 georeferenced · 1 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤1 km 14≤10 km 12>10 km 3

29 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	9
Pullman, US	7
DPIlocation not on record	6
Toronto, CA	4
Catholic University of Pekinglocation not on record	4
Helsinki, FI	4
University of Tennessee at Chattanoogalocation not on record	3
WTUlocation not on record	2
Madison, US	2
Mlocation not on record	1
Ann Arbor, US	1
Museo Entomologico de Leonlocation not on record	1
Norwegian Institute of Bioeconomy Researchlocation not on record	1
Auckland, NZ	1
McWane Science Centerlocation not on record	1
ILLSlocation not on record	1
WU-MYClocation not on record	1

17 institutions · 49 of 49 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)