Dicyrtomina saundersi

(J.Lubbock, 1862) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Collembola/Symphypleona/Dicyrtomidae/Dicyrtomina

At a glance

Occurrence records5 351

Data sources8

Biological traits0

DNA specimens85

eDNA detections736

Sources8 archives

Databases and archives Dicyrtomina saundersi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 351 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI736 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics85 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 351 records

Environmental DNA4 datasets · 6 countries736 detections

DNA & barcodingBOLD85 specimens

Genome at a glanceGoaT · NCBI≈585 Mbp

01Narrative

Dicyrtomina saundersi is een springstaartensoort uit de familie van de Dicyrtomidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1862 door Lubbock. Hij leeft onder stenen en boomstammen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding85 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dicyrtomina saundersi has left across the world's sequence archives.

At a glance

DNA specimens85

BINs3

Marker genes2

eDNA detections736

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus77 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

80Amostly conserved

83Amostly conserved

191Tmostly conserved

212Tmostly conserved

218Cmostly conserved

290Gmostly conserved

326Amostly conserved

383Cmostly conserved

398Cvariable

399Tvariable

401Avariable

594Cvariable

623Tmostly conserved

CTATATATCTGATCTTCGGATTTTGATCCGCAATAGTTGGAACAGCTTTTAGAGTATTAATTCGCTTAGAATTAGGACAACCAGGTAGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes18

BINs3

Most divergent pair17.1%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dicyrtomina minutasame genus16.6%Ptenothrix monochromasame family16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_044134 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Dicyrtomina saundersi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈585 047 306 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dicyrtomina saundersi0.59 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96.5% BUSCO

08Occurrence & distribution

Record type5 351 records

Wild obs. + sensor4 193

Museum / vouchered1 158

Range

Area of Occupancy AOO6 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 2 115≤1 km 713≤10 km 242>10 km 224

3 294 georeferenced · 899 without coordinates

Open the mapobservation + sensor4 193

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1 114≤1 km 12≤10 km 2

1 128 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence1 158

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UMUlocation not on record	16
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Universite de Rouenlocation not on record	4
SLU Artdatabankenlocation not on record	4
Tromsø, NO	3
BioFokuslocation not on record	2
Wellcome Sanger Institutelocation not on record	1
No Voucher Tissuelocation not on record	1
Natural History Museum, Londonlocation not on record	1
MOLARTlocation not on record	1
South Kensington, GB	1

11 institutions · 42 of 1 158 vouchered records shown · 1 116 without an institution code

09Environmental DNA736 detections

Where the DNA of Dicyrtomina saundersi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found736

Studies independent surveys4

Countries6

Verifiable raw sequence linked648

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 736 detections have coordinates

Open the map6 countries0

EUNIS G1.5; Broadleaved swamp woodland on ac…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.50 °C 2.50–12.9

Seasonal swing summer↔winter17.0 °C

Max temp (day)10.0 °C 4.50–15.6

Min temp (night)5.60 °C -0.4–10.6

Precipitation75.4 mm/mo 54.1–105

Air humidity66.5 % 63.3–70.8

Moisture balance35.3 mm/mo 0.1–88.1

Vapour deficit347 Pa 201–531

Wind speed4.50 m/s 2.90–7.30

Cloud cover54.0 % 48.3–61.2

CHELSA 1981–2010, ~9 km grid, at location & month of 732 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dicyrtomina saundersi

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 351 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 351 records