Dicyrtomina ornata

(H.Nicolet, 1842) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Collembola/Symphypleona/Dicyrtomidae/Dicyrtomina

At a glance

Occurrence records11 079

Data sources9

Biological traits0

DNA specimens150

eDNA detections803

Sources9 archives

Databases and archives Dicyrtomina ornata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 079 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI803 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics150 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF11 079 records

Environmental DNA3 datasets · 6 countries803 detections

DNA & barcodingBOLD150 specimens

Genome at a glanceGoaT · TreeOfSex2n = 12

01Narrative

Frontansicht Der Bunte Kugelspringer (Dicyrtomina ornata) ist eine Art der Springschwänze. Die aus derselben Ordnung stammende Art Allacma fusca wurde im Jahr 2016 zum „Insekt des Jahres“ gekürt.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding150 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dicyrtomina ornata has left across the world's sequence archives.

At a glance

DNA specimens150

BINs5

Marker genes2

eDNA detections803

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus61 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 80% of positions are identical in every specimen.

Where individuals differ — all 132 variable positions, in barcode order

4Cmostly conserved

6Tmostly conserved

9Cmostly conserved

10Cmostly conserved

12Amostly conserved

15Tmostly conserved

18Tmostly conserved

24Tmostly conserved

27Gmostly conserved

30Tmostly conserved

48Amostly conserved

54Tmostly conserved

58Cmostly conserved

66Amostly conserved

67Tmostly conserved

72Gmostly conserved

73Cmostly conserved

78Gmostly conserved

84Tmostly conserved

87Amostly conserved

90Tmostly conserved

99Gmostly conserved

102Cmostly conserved

117Tmostly conserved

120Tmostly conserved

126Tmostly conserved

156Tmostly conserved

159Amostly conserved

168Cmostly conserved

180Amostly conserved

183Cmostly conserved

189Amostly conserved

192Cmostly conserved

196Tmostly conserved

198Amostly conserved

201Tmostly conserved

219Tmostly conserved

222Tmostly conserved

231Amostly conserved

234Tmostly conserved

240Tmostly conserved

243Amostly conserved

252Gmostly conserved

255Tmostly conserved

258Cmostly conserved

265Tmostly conserved

267Amostly conserved

270Amostly conserved

279Gmostly conserved

282Gmostly conserved

283Tmostly conserved

286Cmostly conserved

289Tmostly conserved

294Amostly conserved

300Cmostly conserved

301Tmostly conserved

306Tmostly conserved

315Cmostly conserved

321Gmostly conserved

327Amostly conserved

333Amostly conserved

339Cmostly conserved

342Tmostly conserved

345Tmostly conserved

346Tmostly conserved

348Amostly conserved

349Tmostly conserved

357Tmostly conserved

363Amostly conserved

366Tmostly conserved

369Gmostly conserved

372Amostly conserved

375Cmostly conserved

378Tmostly conserved

384Cmostly conserved

387Amostly conserved

390Tmostly conserved

399Tmostly conserved

400Tmostly conserved

402Amostly conserved

405Tmostly conserved

411Amostly conserved

414Amostly conserved

420Tmostly conserved

423Tmostly conserved

432Amostly conserved

441Tmostly conserved

444Tmostly conserved

450Amostly conserved

453Tmostly conserved

459Cmostly conserved

468Tmostly conserved

477Gmostly conserved

482Gmostly conserved

499Tmostly conserved

507Amostly conserved

516Tmostly conserved

522Gmostly conserved

525Tmostly conserved

528Cmostly conserved

535Cmostly conserved

537Tmostly conserved

541Cmostly conserved

546Gmostly conserved

549Amostly conserved

555Cmostly conserved

561Tmostly conserved

564Avariable

576Amostly conserved

577Cmostly conserved

579Tmostly conserved

582Tmostly conserved

585Amostly conserved

588Tmostly conserved

591Tmostly conserved

594Tmostly conserved

595Tmostly conserved

600Cmostly conserved

604Tmostly conserved

606Tmostly conserved

+12 more variable positions not shown

ACTCTTTACCTAATTTTTGGATTTTGGTCTGCTATAGTTGGCACTGCATTTAGTGTACTAATTCGATTAGAGCTAGGGCAGCCTGGAAGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.9%

Haplotypes12

BINs4

Most divergent pair20.2%

EuropeN.AmericaOther

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_088437 ↗ · 13 protein · 22 tRNA · 2 rRNA

nad2cox1cox2atp8atp6cox3nad3nad5nad4nad4Lnad6cobnad1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Dicyrtomina ornata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome records10–122n range12median12mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 122×GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Dallai R, Fanciulli PP, Frati F (2004) New data on the aberrant spermatogenesis of Collembola. Pedobiologia 48: 487-492. ↗

2n 101×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type11 079 records

Wild obs. + sensor10 518

Museum / vouchered559

Other2

Origin

Introduced60

Range

Area of Occupancy AOO12 900 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 5 145≤1 km 1 407≤10 km 414>10 km 949

7 915 georeferenced · 2 603 without coordinates

Open the mapobservation + sensor10 518

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 336≤1 km 6≤10 km 1

343 georeferenced · 216 without coordinates

Open the institutions mapphysical evidence559

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	85
UAclocation not on record	60
UMUlocation not on record	54
University of Guelph, Centre for Biodiversity Genomicslocation not on record	41
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	8
BioFokuslocation not on record	8
University of Rouen, ECODIV Laboratorylocation not on record	4
SLU Artdatabankenlocation not on record	3
MOLARTlocation not on record	1
Royal Ontario Museumlocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1

11 institutions · 266 of 559 vouchered records shown · 293 without an institution code

09Environmental DNA803 detections

Where the DNA of Dicyrtomina ornata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found803

Studies independent surveys3

Countries6

Verifiable raw sequence linked705

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 803 detections have coordinates

Open the map6 countries0

Riparian ZoneForestUrbanMixed habitatGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.20 °C 1.90–12.7

Seasonal swing summer↔winter17.5 °C

Max temp (day)7.40 °C 4.70–16.1

Min temp (night)2.70 °C -1.10–10.2

Precipitation84.7 mm/mo 54.7–119

Air humidity67.8 % 59.8–70.1

Moisture balance44.7 mm/mo -10.2–77.1

Vapour deficit290 Pa 224–570

Wind speed4.50 m/s 2.90–5.00

Cloud cover58.3 % 47.3–64.9

CHELSA 1981–2010, ~9 km grid, at location & month of 801 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dicyrtomina ornata

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type11 079 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type11 079 records