Dicycla oo

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Dicycla

At a glance

Occurrence records2 779

Data sources8

Biological traits2

DNA specimens19

eDNA detections0

Sources8 archives

Databases and archives Dicycla oo's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 779 records↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 779 records

DNA & barcodingBOLD19 specimens

Genome at a glanceGoaT · NCBI≈937 Mbp

01Narrative

The heart moth (Dicycla oo) is a species of moth of the family Noctuidae. It is found locally in Europe. It is also present in Turkey, Transcaucasia, the Caucasus, Israel, Iran and Iraq.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dicycla oo has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.02%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

211Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCCCTAAGATTATTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eremohadena marianasame family4.7%Rhiza commodasame family5.2%Aseptis fumosasame family5.5%Xylena formosasame family5.5%Pseudohadena vulnereasame family5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Dicycla oo carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈936 702 010 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dicycla oo0.94 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.8% BUSCO

08Occurrence & distribution

Record type2 779 records

Wild obs. + sensor2 041

Museum / vouchered481

Other257

Origin

Native217

Range

Area of Occupancy AOO4 988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 613≤1 km 266≤10 km 758>10 km 26

1 663 georeferenced · 378 without coordinates

Open the mapobservation + sensor2 041

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 42≤1 km 69≤10 km 294>10 km 2

407 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence481

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sion, CH	33
SLU Artdatabankenlocation not on record	32
Zürich, CH	31
Geneva, CH	28
Provincia di Livornolocation not on record	28
DanishLepidopterologicalSocietylocation not on record	28
SFRAlocation not on record	26
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	25
Nijmegen, NL	18
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	15
UMUlocation not on record	14
Bern, CH	14
Tartu, EE	14
Muzeum Górnośląskie w Bytomiulocation not on record	12
Archäologie und Museum Baselland - Museum.BLlocation not on record	10
Tallinn, EE	8
MZLUlocation not on record	7
Stockholm, SE	6
CBDClocation not on record	6
Naturmuseum St. Gallenlocation not on record	4
Radicondoli, IT	3
Musee d'Histoire Naturallelocation not on record	3
NCMGlocation not on record	3
EGBlocation not on record	2
Museum zu Allerheiligen Schaffhausenlocation not on record	2
Frauenfeld, CH	2
South Kensington, GB	2
ZSMlocation not on record	2
МПХУlocation not on record	1
Tiroler Landesmuseum Ferdinandeumlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Fribourg, CH	1
Research Collection of Rudolf Tannertlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Natural History Museum, Londonlocation not on record	1
ЗММУlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

37 institutions · 387 of 481 vouchered records shown · 94 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dicycla oo

At a glance

Sources8 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 779 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 37 geolocated

Record type2 779 records