Dictyocatenulata alba

Finley & E.F.Morris · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Dictyocatenulata

At a glance

Occurrence records430

Data sources6

Biological traits0

DNA specimens3

eDNA detections3

Sources6 archives

Databases and archives Dictyocatenulata alba's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility430 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF430 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Dictyocatenulata Finley & E.F. Morris (kabuczka) – rodzaj grzybów z klasy miseczniaków (Lecanoromycetes). Ze względu na współżycie z glonami zaliczany jest do grupy porostów.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dictyocatenulata alba has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences6

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKT695389.1 ↗535 bpCanada · 2015

ACGT

AAGGATCATTACCGAGTGAGGGTGTTACTCGCGCCCGTCTCTCCAACCCTGAATATCCTATCTCTGTTGCTTTGGCGGGTCGTGTCGCCG …

Dictyocatenulata alba voucher BIOUG24047-H07 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

08Occurrence & distribution

Record type430 records

Wild obs. + sensor60

Museum / vouchered370

Range

Area of Occupancy AOO1 316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 27≤1 km 7≤10 km 3>10 km 20

57 georeferenced · 3 without coordinates

Open the mapobservation + sensor60

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 366 without coordinates

Open the institutions mapphysical evidence370

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	282
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	11
PHlocation not on record	11
DOI/NPS, Colonial National Historical Parklocation not on record	10
Durham, US	4
ILLSlocation not on record	3
Université Lavallocation not on record	3
University of Gdansklocation not on record	3
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	2
Philadelphia, US	2
University of Guelph, OAC Herbariumlocation not on record	2
Royal Ontario Museumlocation not on record	2
ASUlocation not on record	2
Museum of the Rockieslocation not on record	2
Wuzhou, CN	1
Bergen, NO	1
MeiseBGlocation not on record	1
Madison, US	1
Stockholm, SE	1
Uppsala, SE	1
AUAlocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
St. Paul, US	1
Morgantown, US	1
Oregon State Universitylocation not on record	1

25 institutions · 350 of 370 vouchered records shown · 19 without an institution code

09Environmental DNA3 detections

Where the DNA of Dictyocatenulata alba was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

root of living treelichenized bark of wood

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.30 °C -2.50–17.1

Seasonal swing summer↔winter25.8 °C

Max temp (day)10.5 °C -0.9–21.9

Min temp (night)3.10 °C -6.80–13.0

Precipitation269 mm/mo 119–418

Air humidity64.8 % 60.3–69.3

Moisture balance183 mm/mo -4.20–370

Vapour deficit529 Pa 207–851

Wind speed3.30 m/s 3.30–3.40

Cloud cover50.3 % 42.7–57.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)