Dicrastylis cundeeleensis

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Dicrastylis

At a glance

Occurrence records29

Data sources7

Biological traits17

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Dicrastylis cundeeleensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF29 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Dicrastylis cundeeleensis is a species of plant within the genus, Dicrastylis, in the family Lamiaceae. It is endemic to the south of Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology3

Plant height0.35 m

Plant height max0.5 m

Plant height min0.2 m

Life cycle & reproduction6

Dispersal typeanimal

Life formsubshrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formshrub

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dicrastylis cundeeleensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSGQ381147.1 ↗606 bp

ACGT

ACTAAACAGCAGACCGCGAACACGTGATTAACGACACAGGGCACGCGGCGCGGAGGGAAACCTCCGATCGCGTGGCCACCCCCGCCGGCG …

Dicrastylis cundeeleensis internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type29 records

Museum / vouchered29

Origin

Native2

Range

Area of Occupancy AOO76 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 29

29 georeferenced

Open the institutions mapphysical evidence29

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	23
Mount Annan, AU	2
Museo Entomologico de Leonlocation not on record	2
Adelaide, AU	1
Canberra, AU	1

5 institutions · 29 of 29 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Dicrastylis cundeeleensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.