Dicrastylis corymbosa

(Endl.) Munir · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Dicrastylis

At a glance

Occurrence records64

Data sources5

Biological traits16

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Dicrastylis corymbosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility64 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF64 records

DNA & barcodingNCBIsequences

01Narrative

Dicrastylis corymbosa is a species of plant within the genus, Dicrastylis, in the family Lamiaceae. It is endemic to Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology3

Plant height0.3 m

Plant height max0.3 m

Seed mass0.356 mg

Life cycle & reproduction5

Flowering timeyyyynnnnyyyy

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formshrub

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dicrastylis corymbosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSGQ381157.1 ↗489 bp

ACGT

TGGCCCGAGGTGTGGTGGGAAACCTCCCATCGCGTGGCCATCCCCCGCCGGCCCACGCGCAAGCGTGTCGTCGTGCGGGCTAACGAACCC …

Dicrastylis corymbosa internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type64 records

Wild obs. + sensor1

Museum / vouchered61

Cultivated / captive2

Origin

Native3

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 10≤1 km 3≤10 km 38>10 km 4

55 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence61

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	42
Museo Entomologico de Leonlocation not on record	8
Canberra, AU	4
Mount Annan, AU	3
Adelaide, AU	3

5 institutions · 60 of 61 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)