Dicrastylis brunnea — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Dicrastylis

At a glance

Occurrence records101

Data sources5

Biological traits16

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Dicrastylis brunnea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility101 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF101 records

DNA & barcodingNCBIsequences

01Narrative

Dicrastylis brunnea is a species of plant within the genus, Dicrastylis, in the family Lamiaceae. It is endemic to the south-west of Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology3

Plant height0.5 m

Plant height max0.8 m

Plant height min0.2 m

Life cycle & reproduction5

Flowering timeynnnnnnyyyyy

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formshrub

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dicrastylis brunnea has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSGQ381156.1 ↗540 bp

ACGT

TGGCCCGCGGTGCGGTGGGAAACCTCCCATCGCGTGGCCACCCCCTCGCCGGCCCACGCGCAAGCGTGTCGTCGTGCGGGCTAACGAACC …

Dicrastylis brunnea internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type101 records

Wild obs. + sensor1

Museum / vouchered100

Origin

Native6

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 18≤1 km 11≤10 km 57>10 km 5

91 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence100

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	67
Museo Entomologico de Leonlocation not on record	9
Adelaide, AU	8
Canberra, AU	8
Mount Annan, AU	5
Kew, GB	1
Hobart, AU	1
Palmerston, AU	1

8 institutions · 100 of 100 vouchered records shown