Dicogaster coronada

(Barnes, 1904) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lasiocampidae/Dicogaster

At a glance

Occurrence records297

Data sources7

Biological traits0

DNA specimens7

eDNA detections6

Sources7 archives

Databases and archives Dicogaster coronada's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility297 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF297 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD7 specimens

01Narrative

Dicogaster is a genus of moths in the family Lasiocampidae first described by William Barnes and James Halliday McDunnough in 1911. Its only species, Dicogaster coronada, was first described by Barnes in 1904. It is found in Arizona. The wingspan is 70–130 mm. Adults are on wing from June to August. Larvae have been reared on Quercus oblongifolia and Quercus emoryi.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dicogaster coronada has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

28Gmostly conserved

40Amostly conserved

389Gmostly conserved

400Cvariable

548Cvariable

628Gmostly conserved

AACATTATACTTTATCTTTGGAATTTGGGCAGGAATAGTAGGAACTTCATTAAGTTTACTAATTCGAGCTGAATTAGGAACTCCCAGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gloveria gargamellesame family8.5%Caloecia juvenalissame family9.0%Gloveria howardisame family9.6%Gloveria medusasame family10.0%Pachyplocia griseatasame order10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type297 records

Wild obs. + sensor47

Museum / vouchered250

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 27≤1 km 7≤10 km 1>10 km 1

36 georeferenced · 11 without coordinates

Open the mapobservation + sensor47

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 41≤1 km 21≤10 km 149>10 km 6

217 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence250

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	155
East Lansing, US	29
University of Alabamalocation not on record	16
Mississippi State, US	8
Facultad de Ciencias Biológicas y Agropecuarias, Universidad de Colimalocation not on record	8
Colorado State Universitylocation not on record	7
Cleveland Museum of Natural History, OH (CLEV)location not on record	6
New Haven, US	5
Washington, US	4
Universidad Católica de Manizaleslocation not on record	3
Natural History Museum of Utahlocation not on record	2
Cornell University Insect Collectionlocation not on record	2
University of California, Davislocation not on record	2
Ciudad de México, MX	1
King Saud Universitylocation not on record	1
San Francisco, US	1

16 institutions · 250 of 250 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Dicogaster coronada was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 11.2–22.3

Seasonal swing summer↔winter18.2 °C

Max temp (day)23.5 °C 18.6–29.3

Min temp (night)12.1 °C 3.80–15.2

Precipitation69.6 mm/mo 17.4–119

Air humidity48.3 % 40.2–53.9

Moisture balance-78.2 mm/mo -142–-30.7

Vapour deficit936 Pa 759–1,448

Wind speed2.90 m/s 1.90–3.80

Cloud cover22.0 % 19.6–27.6

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)