Dichrorampha petiverella

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Dichrorampha

At a glance

Occurrence records6 349

Data sources10

Biological traits2

DNA specimens58

eDNA detections145

Sources10 archives

Databases and archives Dichrorampha petiverella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 349 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI145 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics58 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF6 349 records

Environmental DNA4 datasets · 15 countries145 detections

DNA & barcodingBOLD58 specimens

Genome at a glanceGoaT · NCBI≈1.1 Gbp

01Narrative

Dichrorampha petiverella is a moth of the family Tortricidae. It is found in the Palearctic realm. Mounted The wingspan is 10–13 mm. The forewings are dark fuscous, posteriorly irrorated with pale orange ochreous. The costa is posteriorly strigulated with whitish . There is a sharply marked whitish -yellowish rather narrow curved transverse median dorsal blotch and two dark leaden-metallic oblique streaks from the costa posteriorly. There are three or four black dots on the termen towards middle, and a whitish subapical dash. The hindwings are dark fuscous, lighter basally.The larva is pinkish-white; head yellowishbrown; plate of 2 brownish-tinged :Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description The moth flies from April to August. . The larvae feed on Achillea millefolium and tansy.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding58 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dichrorampha petiverella has left across the world's sequence archives.

At a glance

DNA specimens58

BINs1

Marker genes1

eDNA detections145

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus55 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

232Avariable

334Gmostly conserved

364Cmostly conserved

403Amostly conserved

412Cmostly conserved

517Amostly conserved

553Avariable

628Amostly conserved

634Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAATTGGAACTTCATTAAGATTATTAATTCGTGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.62%

Haplotypes22

BIN1

Most divergent pair1.5%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dichrorampha gemellanasame genus3.7%Dichrorampha sedatanasame genus4.0%Dichrorampha pentherianasame genus4.1%Dichrorampha vancouveranasame genus4.3%Dichrorampha sylvicolanasame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Dichrorampha petiverella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 073 852 344 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dichrorampha petiverella1.07 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.5% BUSCO

08Occurrence & distribution

Record type6 349 records

Wild obs. + sensor5 169

Museum / vouchered1 080

Other100

Range

Area of Occupancy AOO14 116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 2 289≤1 km 1 556≤10 km 816>10 km 18

4 679 georeferenced · 490 without coordinates

Open the mapobservation + sensor5 169

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 432≤1 km 283≤10 km 225

940 georeferenced · 140 without coordinates

Open the institutions mapphysical evidence1 080

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	253
NHMOlocation not on record	115
Provincia di Livornolocation not on record	85
Tartu, EE	65
Kuopio, FI	54
SLU Artdatabankenlocation not on record	32
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	27
European Distributed Institute of Taxonomy (EDIT)location not on record	18
Nijmegen, NL	14
ZMAAlocation not on record	13
Stockholm, SE	12
Philadelphia, US	12
Salzburg, AT	9
neflocation not on record	5
MZLUlocation not on record	5
BioFokuslocation not on record	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Uniwersytet Łódzkilocation not on record	3
Tallinn, EE	3
South Kensington, GB	3
ZSMlocation not on record	2
Durban Natural Science Museumlocation not on record	2
Rovaniemi, FI	2
DABUHlocation not on record	2
University of Kaiserslauternlocation not on record	2
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	2
Natural History Museum, Londonlocation not on record	1
Zürich, CH	1
KIRMlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1

30 institutions · 751 of 1 080 vouchered records shown · 329 without an institution code

09Environmental DNA145 detections

Where the DNA of Dichrorampha petiverella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found145

Studies independent surveys4

Countries15

Verifiable raw sequence linked77

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 145 detections have coordinates

Open the map15 countries0

GrasslandGarden lawnPin - Mixte1. Forest & WoodlandPin - MixteMixte - Champs

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 13.1–17.7

Seasonal swing summer↔winter18.5 °C

Max temp (day)19.5 °C 16.1–21.9

Min temp (night)11.8 °C 7.80–13.8

Precipitation81.7 mm/mo 61.4–118

Air humidity60.7 % 58.0–61.9

Moisture balance-35.3 mm/mo -61.6–10.9

Vapour deficit696 Pa 588–845

Wind speed2.90 m/s 2.30–4.20

Cloud cover43.5 % 34.7–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 145 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dichrorampha petiverella

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type6 349 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 349 records