Diaporthe perniciosa

Marchal & É.J.Marchal · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Diaporthales/Diaporthaceae/Diaporthe

At a glance

Occurrence records46

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Diaporthe perniciosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility46 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF46 records

DNA & barcodingNCBIsequences

01Narrative

Diaporthe perniciosa a species of fungus in the family Diaporthaceae. It is a plant pathogen. The names Phoma prunorum Cooke, Phomopsis prunorum (Cooke) Grove, and Phomopsis mali Roberts have been used for its asexual (anamorph) form. It causes bark cankers on trees in the genera Malus (apples), Pyrus (pears) and Prunus (plums, cherries, peaches and other similar fruits). It has also been implicated in dieback disease of plums. One study in the late 1980s was able to isolate the fungus from several trees with die-back symptoms but inoculation of healthy trees with the fungus did not result in disease.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diaporthe perniciosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSHQ908492.1 ↗475 bp

ACGT

CCAGAAACCCTTTGTGAACTTATACCTTACTGTTGCCTCGGCGCTAGCTGGTCCCTCGGGGCCCCTCACCCTCGGGTGTTGAGACAGCCC …

Diaporthe perniciosa strain ATCC 38578 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type46 records

Wild obs. + sensor11

Museum / vouchered34

Cultivated / captive1

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 11

11 georeferenced

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 34 records without

Open the institutions mapphysical evidence34

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	25
DPIlocation not on record	6
MeiseBGlocation not on record	1
LDlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

5 institutions · 34 of 34 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)