Diaporthe citri

(H.S.Fawc.) F.A.Wolf · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Diaporthales/Diaporthaceae/Diaporthe

At a glance

Occurrence records112

Data sources9

Biological traits0

DNA specimens82

eDNA detections83

Sources9 archives

Databases and archives Diaporthe citri's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility112 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI83 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics82 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF112 records

Environmental DNA2 datasets · 2 countries83 detections

DNA & barcodingBOLD · NCBI82 specimens

Genome at a glanceGoaT · NCBI≈64 Mbp

01Narrative

Diaporthe citri is a plant pathogen infecting citruses.Zeki Berk, Citrus Fruit Processing, 2016, Chapter 6.7, , DOI https://doi.org/10.1016/C2014-0-03617-9

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding82 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diaporthe citri has left across the world's sequence archives.

At a glance

DNA specimens82

Marker genes2

GenBank sequences10

eDNA detections83

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPP921201.1 ↗422 bpIndia · 2021

ACGT

CTGAGGCCCCCTGGAGACAGGGAGCAGCCCGCCGGCGGCCAACTAAACTCTTGTTTCTATAGTGAATCTCTGAGTAAAAACATAAATGAA …

Diaporthe citri isolate ZLP8 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Diaporthe citri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈63 685 968 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Diaporthe citri0.06 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness95.9% BUSCO

08Occurrence & distribution

Record type112 records

Wild obs. + sensor1

Museum / vouchered105

Cultivated / captive6

Range

Area of Occupancy AOO240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 1≤1 km 2≤10 km 14>10 km 15

32 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence105

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	42
DPIlocation not on record	21
Bernard Price Institute for Palaeontological Researchlocation not on record	16
FLASlocation not on record	11
Chapel Hill, US	2
Pullman, US	2
Catholic University of Pekinglocation not on record	2
Bronx, US	1
Kensington, AU	1

9 institutions · 98 of 105 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA83 detections

Where the DNA of Diaporthe citri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found83

Studies independent surveys2

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 83 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 16.6–26.2

Seasonal swing summer↔winter2.20 °C

Max temp (day)29.7 °C 21.0–30.1

Min temp (night)21.3 °C 11.7–22.9

Precipitation164 mm/mo 90.6–190

Air humidity64.0 % 59.4–68.4

Moisture balance32.9 mm/mo -9.90–62.6

Vapour deficit1,056 Pa 837–1,134

Wind speed1.20 m/s 1.10–2.30

Cloud cover40.9 % 40.8–44.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)