Diaphus adenomus

Gilbert, 1905 · species

image placeholder — illustration coming later

Animalia/Chordata/Myctophiformes/Myctophidae/Diaphus

At a glance

Occurrence records289

Data sources8

Biological traits6

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Diaphus adenomus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility216 records↗

OBISOcean Biodiversity Information System73 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS289 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Diaphus adenomus est une espèce des poissons téléostéens.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length18 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Other traits3

Depth max600 m

Depth min180 m

Vulnerability11.96

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diaphus adenomus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P684 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.54%

Haplotypes2

BIN1

Most divergent pair0.73%

Where individuals differ — all 5 variable positions, in barcode order

3Cvariable

9Cvariable

192Cvariable

678Cvariable

681Cvariable

CACAAAGACATTGGCACCCTCTACCTAGTATTTGGTGCCTGAGCAGGCATGGTCGGAACTGCTCTTAGCCTCCTTATCCGAGCCGAACTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Diaphus taaningisame genus5.7%Diaphus wataseisame genus6.0%Diaphus coeruleussame genus7.7%Diaphus fragilissame genus8.4%Diaphus ostenfeldisame genus8.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type289 records

Wild obs. + sensor14

Museum / vouchered274

Other1

Origin

Native2

Range

Area of Occupancy AOO304 km²

Depth

0–200 m sunlit1

200–1000 m twilight19

1–4 km midnight1

>4 km abyssal0

median 390 m · max 1 736.5 m · 21 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 2≤10 km 3>10 km 1

6 georeferenced · 268 without coordinates

Open the institutions mapphysical evidence274

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	134
Washington, US	42
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	8
CASlocation not on record	4
IEOlocation not on record	4
University of California San Diegolocation not on record	4
IEO-COMA-CSIClocation not on record	3
Los Angeles, US	2
Kagoshima University Museumlocation not on record	2
South Kensington, GB	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Mexico City, MX	1
FishBaselocation not on record	1
Honolulu, US	1
Chicago, US	1

15 institutions · 210 of 274 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Diaphus adenomus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)