Diaphorina citri

Kuwayama, 1908 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Liviidae/Diaphorina

At a glance

Occurrence records851

Data sources8

Biological traits0

DNA specimens1 455

eDNA detections1 447

Sources8 archives

Databases and archives Diaphorina citri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility851 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 447 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 455 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF851 records

Environmental DNA2 datasets · 19 countries1 447 detections

DNA & barcodingBOLD1 455 specimens

Genome at a glanceGoaT · NCBI≈524 Mbp

01Narrative

Le psylle asiatique des agrumes (Diaphorina citri) est une espèce d'insectes hémiptères de la famille des Psyllidae. Cet insecte suceur de sève est considéré comme un ravageur important des cultures d'agrumes. C'est en effet avec Trioza erytreae, l'un des deux seuls cas confirmés de vecteurs d'une bactérie, Candidatus Liberibacter africanus, agent d'une grave maladie des agrumes, la maladie du dragon jaune ou Huanglongbing. Le psylle asiatique des agrumes est largement répandu en Asie méridionale et s'est diffusé dans d'autres régions agrumicoles.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 455 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diaphorina citri has left across the world's sequence archives.

At a glance

DNA specimens1 455

BINs1

Marker genes3

eDNA detections1 447

Countries28

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P151 bp consensus815 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

CTTCCGGGGTTTGGGCTAATCTCACATATTACTACACAAGAAAGAGGTAAAACTTCAGCATTCGGTACATTAGGAATAATTTATGCTATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.03%

Haplotypes8

BIN1

Most divergent pair2.0%

AsiaN.AmericaS.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5PCYTB

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_030214 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Diaphorina citri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈523 778 681 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Diaphorina citri0.52 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness88.3% BUSCO

08Occurrence & distribution

Record type851 records

Wild obs. + sensor493

Museum / vouchered358

Range

Area of Occupancy AOO1 532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 176≤1 km 59≤10 km 54>10 km 68

357 georeferenced · 136 without coordinates

Open the mapobservation + sensor493

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 358 records without

Open the institutions mapphysical evidence358

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	162
Montgomery, US	27
Universidad Nacional de Colombia (UNAL)location not on record	12
University Park, US	3
DPIlocation not on record	3

5 institutions · 207 of 358 vouchered records shown · 78 without an institution code

09Environmental DNA1 447 detections

Where the DNA of Diaphorina citri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 447

Studies independent surveys2

Countries19

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 447 detections have coordinates

Open the map19 countries0

14. Artificial - Terrestrial | 14.2 Pasturel…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 15.6–26.2

Seasonal swing summer↔winter4.30 °C

Max temp (day)30.2 °C 19.7–30.5

Min temp (night)21.0 °C 10.1–22.3

Precipitation143 mm/mo 13.6–177

Air humidity64.0 % 45.9–65.8

Moisture balance9.40 mm/mo -124–43.7

Vapour deficit1,154 Pa 648–1,844

Wind speed1.80 m/s 1.10–3.80

Cloud cover45.9 % 21.6–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 184 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)