Diaphoreolis viridis

(Forbes, 1840) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Trinchesiidae/Diaphoreolis

At a glance

Occurrence records86

Data sources8

Biological traits6

DNA specimens28

eDNA detections22

Sources8 archives

Databases and archives Diaphoreolis viridis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility86 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF86 records

Environmental DNA1 datasets · 3 countries22 detections

DNA & barcodingBOLD28 specimens

01Narrative

Diaphoreolis viridis is a species of sea slug, an aeolid nudibranch, a marine gastropod mollusk in the family Trinchesiidae.Picton, B. (2017). Diaphoreolis viridis (Forbes, 1840). In: MolluscaBase (2017). Accessed through: World Register of Marine Species on 2017-11-01.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length1.1 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits3

Depth max10 m

Depth min4 m

Vulnerability10

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diaphoreolis viridis has left across the world's sequence archives.

At a glance

DNA specimens28

BINs4

Marker genes1

eDNA detections22

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 43 variable positions, in barcode order

6Amostly conserved

16Cmostly conserved

18Amostly conserved

42Gmostly conserved

57Gmostly conserved

93Tmostly conserved

94Cmostly conserved

114Cmostly conserved

141Cmostly conserved

168Cmostly conserved

228Gmostly conserved

249Cmostly conserved

280Tmostly conserved

300Tmostly conserved

301Cmostly conserved

309Amostly conserved

312Amostly conserved

327Amostly conserved

336Gvariable

342Cvariable

354Cmostly conserved

357Amostly conserved

363Cmostly conserved

384Cmostly conserved

390Cmostly conserved

399Tmostly conserved

402Tmostly conserved

406Cmostly conserved

432Amostly conserved

435Tmostly conserved

441Tmostly conserved

444Cvariable

474Tmostly conserved

477Amostly conserved

489Cmostly conserved

507Cmostly conserved

532Tmostly conserved

540Tmostly conserved

580Tmostly conserved

606Amostly conserved

618Amostly conserved

633Cmostly conserved

639Tmostly conserved

ACTTTATACCTTTTACTAGGTATTTGATGTGGGCTTGTAGGGACAGGCCTTAGATTGCTTATTCGTTTTGAATTAGGGACGGCAGGAGCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes14

BINs4

Most divergent pair10.5%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Diaphoreolis lagunaesame genus12.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type86 records

Wild obs. + sensor35

Museum / vouchered48

Other3

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 21≤1 km 10≤10 km 2

33 georeferenced · 2 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 20≤1 km 13≤10 km 4>10 km 1

38 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence48

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	15
Bergen, NO	12
DASSHlocation not on record	9
Gothenburg, SE	4
Natural History Museum Rotterdamlocation not on record	2
Tromsø, NO	1
CASlocation not on record	1
Royal British Columbia Museumlocation not on record	1
WoRMS Editorial Boardlocation not on record	1
PNHSlocation not on record	1

10 institutions · 47 of 48 vouchered records shown · 1 without an institution code

09Environmental DNA22 detections

Where the DNA of Diaphoreolis viridis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map3 countries0

On kelpRockMixed bottomHardbunn

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median3.10 °C -0.4–7.20

Seasonal swing summer↔winter12.1 °C

Max temp (day)4.10 °C 2.00–8.80

Min temp (night)1.00 °C -3.80–5.00

Precipitation158 mm/mo 42.0–308

Air humidity62.6 % 60.5–64.4

Moisture balance121 mm/mo -7.30–264

Vapour deficit284 Pa 258–379

Wind speed4.50 m/s 3.80–6.30

Cloud cover51.3 % 48.2–57.0

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)