Diaphone eumela

Stoll, 1781 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Diaphone

At a glance

Occurrence records989

Data sources7

Biological traits0

DNA specimens9

eDNA detections4

Sources7 archives

Databases and archives Diaphone eumela's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility989 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF989 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD9 specimens

01Narrative

Diaphone eumela, the cherry spot or lily borer, is a moth of the family Noctuidae. It is found in Lesotho, Mozambique, Namibia, South Africa and Angola. Like its relative, Brithys crini, this noctuid is found almost exclusively on plants of the families Amaryllidaceae and Liliaceae, and has been recorded feeding on Ornithogalum eckloni and Boophone disticha.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diaphone eumela has left across the world's sequence archives.

At a glance

DNA specimens9

BINs3

Marker genes1

eDNA detections4

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 41 variable positions, in barcode order

1Avariable

46Tvariable

56Tvariable

74Tmostly conserved

79Amostly conserved

85Amostly conserved

106Tmostly conserved

127Tmostly conserved

157Tvariable

178Tmostly conserved

184Avariable

202Tmostly conserved

205Avariable

220Tmostly conserved

241Tvariable

250Tmostly conserved

263Cvariable

265Tvariable

268Tvariable

271Tvariable

280Amostly conserved

313Tmostly conserved

382Tvariable

406Cvariable

415Avariable

442Tmostly conserved

477Gvariable

484Tvariable

506Avariable

526Tmostly conserved

529Cmostly conserved

532Tmostly conserved

539Tvariable

574Tmostly conserved

581Tmostly conserved

595Tvariable

607Tmostly conserved

616Tmostly conserved

625Amostly conserved

634Cvariable

646Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes6

BINs3

Most divergent pair4.6%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Conisania aridasame family3.5%Lacanobia oleraceasame family3.6%Sideridis fuscoluteasame family3.6%Conisania poellisame family3.8%Brithysana speyerisame family3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type989 records

Wild obs. + sensor952

Museum / vouchered37

Range

Area of Occupancy AOO2 208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 598≤1 km 112≤10 km 28>10 km 27

765 georeferenced · 187 without coordinates

Open the mapobservation + sensor952

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 2≤10 km 1

3 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban Natural Science Museumlocation not on record	12
National Museums of Kenyalocation not on record	10
Tartu, EE	2
New Haven, US	1
ZSMlocation not on record	1

5 institutions · 26 of 37 vouchered records shown · 11 without an institution code

09Environmental DNA4 detections

Where the DNA of Diaphone eumela was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 18.7–24.4

Seasonal swing summer↔winter2.60 °C

Max temp (day)25.5 °C 23.7–28.2

Min temp (night)14.6 °C 13.5–20.7

Precipitation121 mm/mo 71.5–156

Air humidity58.2 % 57.5–62.8

Moisture balance-21.3 mm/mo -54.8–12.0

Vapour deficit984 Pa 921–1,136

Wind speed2.70 m/s 2.50–3.10

Cloud cover41.1 % 33.3–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)